Description :
From Genome Similarity Track
Location :
Scaffold_18:386540- 387794
Transcript NameFunction/comments
Aphas_H257_08274pyruvate dehydrogenase E1 component subunit alpha p

Sequence
1254 bases(100 bases per row)
CGTTGAACATGCTCAGCCGATTGCAACGCTCCCTGAAGCCCGCAGTGCTGTCCCGCGGATTTGCCGCCGCCGCGGACGGCCATAATTTTGAGCTGGCGCG
TCCGTTCAAGCTGCACAGTATGTCACCATCTCCCCCTGTGTCTCGGTAAGCTGCTTACCGAGGTCGTCGATTGTGTAGACTTGGAAGAAGTCCCCGCCAA
TGGCAACCACGCGTTTGCCACCCGCGACGAGTTGTTGGGGTACTACCGCCTCATGTACACGATGCGCCGCATGGAGATCACGTGCGACAACGAGTACAAG
GCGCGTACGATCAAGGGGTTCTGCCACTTGTATGACGGACAAGAAGCCGTCGCGACGGGCGTGGAAGCCGCGCTCGCGCGCTCCGACTCGTGGATCACGT
CGTACCGATGCCATTGCACCATGTTGGCCCGCGGTGGGTCTGTCGCGAGCATCCTGGCCGAATTGTTTGGGAACAAGAGCGGCGCCATCGGCGGCAAGGG
CGGGTCCATGCATTTCTACAACAAGAAGGAAAACTTTTATGGCGGTCAAGGCATCGTCGGCGCCCAAGTGCCCGTGGGTGTGGGTCTGGCGTTCGCGTCC
AAGTACAACCACAAGGGCGACGGCCCTATGCCGTGCTCCATCACCATGTTTGGCGACGGCGCCGCCAACCAGGGCCAGATCTGGGAAGCGGTCAACATGG
CGGCGCTGTGGAAGCTGCCGGCGATCATCTGTATTGAAAACAACCACTACGGAATGGGTACCTCCACGGAGCGCCACTCGAGCAACCAAAACTACTACAC
GATGGGCAACAAGATCCCAGGCATTTGGTGCGACGGCAACGACGTGCTGGCCGTCCGCGAGTGCGCGACGTTCTTGAAGGAATGGACGGGTGCCAACAAG
GGCCCGATCTACGTCGAAATGTGCACGTACCGATACCATGGCCACTCCATGTCGGACCCTGGGGTCACGTACCGCAACCGCGAGGAAATCTCGAACATGC
GCGCGTCGCGCGACCCGATCGAAAGCGTCAAGAAGCGTCTGCTGGAAAGCGGCCTTGCCACCGCTGACGAGATCAAGGAGATTGAGAAGGACGTGCGGAA
AGAAGTCGTCGAAGCCACCAAGGAGGCCAAGGCCAGCGGCCGCCCCGACGACGCCATCGCGTTCAAGGACGTCTACTCGGACGCGAACGGCAAGAACGAG
TTTCCTCCGTTCATCCGTCGCCCAGATATCACCAAGAGCTTGTACCATGGCAAG