Description :
From Genome Similarity Track
Location :
Scaffold_478:3865- 8418
Sequence
4553 bases(100 bases per row)
TTGTTTTGCCGCAATCTGACGCTTGCGATCGCTAACTGCAACTCACATACTTAAATAACCCCTTACACAATCTCATGCAACCTCCTTGCACCGATACAGC
CACTCCACCTTTTTAATTTTTATTAATCTTCGGCTTTCGCTTCATGAGATTGCATCGCCTCGAAACGGTTCTTGCTCGCACGATCATGATCAAATTTTGG
CAGGAAGGTTCCACAGTTCAGATCGGCTTCATCAATCCAGAAAGGATTACATTTATTTTCCATTATACCAGATAATGCCCATGGACCCTCCCATATCGGT
TCTTTGGTCCCTAGTGCGCATCAATTATCTTATCCACTTCAGATTCATCTACGTCCAGATCACCCCCAACTATATTCTTGTAGTAAGGAGTTATCAAAAT
CGAATCCGTCCGCCTCATCAACATTGAACGATTGGTAGGGACTTTTGGGAATGCCCAAACATGCTTCAATTTAGAAACAAGAGCTACGGGGAACAATAGG
CAAGGTATACCTGCAATCTATAAACGCACCGCGTGATAGCCACATCTTTCAGCCACAAGAAACGGTCCATGCCACATATGGGTTAACATTTGAGTATATT
ACTTCTTAGCGCGATCCAGATACATCCAAACCTACGATCCGCGACAAACATCCAGTAAGTCGCGATCCTTATTATGAATATCGTCTCTATCTGGATTGCA
ATATTAAGTAGATGTTTCACCACAGCCCTTACATGCTGATACTGGGGTCGTATGACATATCGCCATCATCTTGGGTTCCGATAACGAGGTTTGGTGCTTC
TTAACGGTAGGTTTGCTTTTAAAGCTCGTTGATTTCAACTGAAAAACAAGTAAAAAGACGAATCCACACGGACTCCATCCTACGCGTTGTTAATTGCATA
AGTTAATTGTTCTGCGTATTAATGTCAGTCCTTTTGATTTTCGTCCATGACATAAACCTTAATCGCTGGGGTCATTATCTGCACCATACTTCCCGCTGTA
CCATTAGCTTGTGGCAAATAAGCCATGGTGGCCTGCTGTTTCCCCGCAATCCGATTAAAAGATTGGAAGGTAGTGAACACAAATACGGCTACTGATCGTG
GTGCATTGCCTCGATTGCACCAAACCGTCTGGATACACATTCCTCATACTTCTCTGCGATCTTTTGTGCAGTCACAAAATAAGAAAAGAAAAACAACCCA
CAATACCAGATCTGTATTCCCTGAAAAGTATCACGATAAACAAGAAACATGATCGATAGCCACAACATTGAAAGGGTACATCACTAATTGTAAATTACCA
GGTGATCTGCATAAAATTAAGTGGTCTTCTTTTTCTCGTTTTTCAGTCAACACACTCTCTCGACTATCGTTGCACGCTTCTGTACAAGGTTAACCAATGG
AAATTTGCCCTGATCCATTATTAGATGCAATTGCCCCTTGGGGTCAACCCTCCAGACTTGTATGATAGTAGTGCAAGAAATCTTGCTGTAGTAGTTCTGC
GAACACCAAGAAAACCGCTTCAGTACTATCCTCCGATTAGGCGATCGATATCGGCAAAACAATGACAGTCCACTTTGTCCTACCTCATCCAGTGCAATCA
GGATGACGACCTTTGATTCTGCCATTAATAGCGTAGCCACATCTCCTGTCAATAATATGTTTATAAATTGAATATTCATTCTCTTGACCTTGCGCTTGCT
TGACATGATCGATCCGTAGTTTCTATACAGCCTCTTCTTGTAAAATTTCGTCTGGCAACGTCTTTCCTGGTGGATCGAGTGATAGTATCCACTTTGACCG
TGTGATCGGTCCGTTTTGTTTGAGCAACTAGCTTAATTGATTAATAGTGATCAGTTCCTGACGATTTTGACCATATACCACAACTTTCCTCATCTCTCGG
TTTAGAGCGTCACCCGCTATCCTATCTGACCCCTGATTTCAGCTCCGCATCATAATAAGAATCACTTTATTGACCATGATATGAGTCGCTTTTTAGCTTG
ATGACGTACAAAATTGTAGTCCTAAGGCATTGCAGTCGATCCCCCCTCGCATTTGACATATCATCAAATTAATCCCCACATATAACCCTTCACCCCCTGG
TTTGATCAGGAAGCACATCGAATCTGAGGAGTAACCCTATGCCCACCGCCTCATTCACATTCAGGTCAAGGATAAACTTGGAAGCACCCTCTACGATATC
CAATCGGGAATTTACATATGATCGTGCTGCATGCTCCACGTTTCCTTTCACCCTAGCTGATCCCTAAGAACTCAATATTAGGAGGTTTTCGTCTGCTATG
GCTGTAGGTTGGGGAATACTTGTCGTCTTTCTCGAATTTTTACGTGGGGCAATATCAGCTAACACCTCGTCCAATTTCTCTGAAGGTGTCACACTCGCAG
CCAGTTTACCCAGCAGCTCCACTTTGCCCTTCTCAGATTGACAAAACTCCATAATTCAATCGATTAGCAACTCAGCCCATATTTGTAACCGTTTGTTGAG
GTCAGAGGATTGCAATAAGCATGTCATTGGTGAATATCGCGTAAGGACCGTAATCCCGCGTGATACCAGCATGCAAAACTATCGAACAATCGAGGAGATA
TAGCACCTCTTTCTCGACTATTCCGTAATTAAATTCGTTAGGCTTCAACGTACAATTACAACATGTTCGGCCAATACACCCTCTCATGCTCTTGGAGTAA
CGCAGCCGATAATACCCACCTACTGGCATATACTACGATCACATGCCATTCATCGAGATGGAAATGTTACAAAATTAGTGTTGTAAATATTTTAGCTTTT
TATTAGCGTAAATGCAATTTCTGCCTTCTCTAATGACCCCTGCTCTCGGGATTGCGATCGTGCCCATCATGGAGTGCAGATCGCGATCGTGTTTCAGTCC
GGGGTCAAGTTTGGAAGTATGAGCATCCCTCGTGCGGCTAATTTTGTGGATATCTTTTTCATACAGCACAGATGCATCGATAGCGAAGTCCTCAATAAAT
ATTCTATAGTCATTTAGACTTCCCGGAAATGTTCGCATCAATCTCCACGTCCGAGGAAATGGGGGTATTCACCAGCAGTTCCAAATTGTTCGTATTAGCT
TCAAAACCGCCAGCAAAATTGATGTCCTAGGTATTCCTACCGTACGACGTCCCAAATATATAAGATAAGTTGATCGACAGTATCCACTCATTGCATCCAC
TCAAAAACCGCCAAGACTTTTTATAGAGGGAATACCACGACCTGGCAGGTATCAGTATATAGTCGGTATATAATCTCCGACCCAATACCGACGGACTTGG
GTCAATGTCTGGCGTCTCTTCAGTGAACGCATCGATATATTTTGACAGTTCAGCCATGATCGAGTAATGTCCCGCAACAAGTTTCAAATATCCGTACAGA
ACGTTATCGATCAAGCACTTGTAAATCTGATGAAATTTCTTCAATTCAAAGGGCGTCCGTAACCACTCAAATAACCCTGACGGTGTGATAAATGCGAAAA
TCTACCTCGCTCGTTCTGTCATCTCAACGACCTAAACTCTACTCGCCATAGCAAGGTAGAAATACCAATTTCATTGCTTTATCCACGCCCTCCAACAATT
CACTAGTCAGAGTAATAGGGTATAACCATCAATCTTGTCAACTAATTTCACCCGCCTATGATTAATACACAGCTTTATGTCCTCGTCGTTCATCTGGGTA
ATTACCACAATTGGCGAAGCCATGAGAGGTGGATGACCGTATGATCATGGCCGATAACAATCCTTAATTAGATCAGCAAGCTCCTCTATGAATATTAGGT
GGATGACCGTATGATCATGGCCGATAACAATCCTTAATTAGATCAGCAAGCTCCTCTATGAATATTAAACTTACAGTATAGACCATCTGCTCCGTCGGAT
TAGCCCCTTCCACATCGATAACAAAAAGTGATTCATGCGCCGCAGGAGTTAGAGAATTAAATTGCCTAATGAGTGAAATACGGCTTTTCCAAATGAACTG
ACGTTATCCTAAACGTCCGTCGTTAGCACTCCTGGACCACCTACTTGAACATCTTCGATCGTTATCTCTTTAGTAGGTGTCACAACTTCTGGTAGAACCG
CCATGTGCTGATCGACATCTTCAGCGAATAGCTCGCCGCGTTTATGACAATATATCGATGTGACAGGATTTTTCTTCCGTTATCTCCTCACCGATAGCAG
TATATCAGAATTTTTAACCAGTTGATCGACCTGCTCGTAACTCACGATCTTCGACCGTGATCTCGTCTGTCTGTTGGCTGAACTGTTTGAGAACCGGATC
AGCTTCCTCAATATCATTATGTTCGATTCCACTCACACCCCGTATCGTTGTGTCGGCTGTTTTCATACTTAACGAATACCTTCCGCGGTTTTTATCATAT
CGATCACCGTAGAGGTCGCAACATCTCTTCTTCTTCCACAGACGTTTTGGTCCCTACCCTATCATAATTTCTGACTAAATATGTCGGGTTGTTAATGCAA
ATCAACATCGTTAATCGAGATCGCGTCTGACTAATGACTGGACTGTTCGTACA