Description :
From Genome Similarity Track
Location :
Scaffold_17:386414- 391577
Transcript NameFunction/comments
g4700.t1hypothetical protein
g4701.t1hypothetical protein

Sequence
5163 bases(100 bases per row)
TGGCGAGCAGCAGCAGGGCCAGACGACCGAGACGGCTGTGTCGGGCTCCATTGGCGTGGACATCACGGCGCAGGGCGGCGAGTCGGCCGAAACCCCTTGC
TCGGGCGACCAGAGCTCCACCGGCACGTGGGGTCAATCCACTGAGACCGCCACCAGCTCGACGGGTACGCAGCAGCAGGGCCAGACATATTTTGGCGTTT
GGGGTCAGTCGAGTATCGGAACGAACGGGAGTACGAATACCCAACAGCAGGGCAAAAGCTCGACAGGCACATTGGGTGTGACAACCCACGCGACTGTGTC
TGGCTCAATCGGTGTACAGGGTGCCGAATCTGCTGGCATTCCGTGCTCCAGCGACCATAGCTCGACGGGAACGACTTCGGCTTGGTCTACGCCGGATTAC
AAGCATGGTGTTGCATCTGGCACGGTCTCGTCCGTGACTTCAAGTGCCACTGAAGCGCCCTTGACGTCGATCGCTTCGACCACGACTAGCACTACCAGAT
CTGGCAAGACTGGTGTGTCGACTACATCGGCGTCAGCCGCGTCTTCGGCCACCTCGTCGGGGGATTCGTACGCAGACTCGAACACGCAGCAATCGGCCAC
TCAGTCCCGCCGTGCCCTTCGCCACTAAGGAATTTTCTCATCGGAAAAGGAGGGTTAGCTGCCAACGCGGAGCGGCGATTTGCATATCATGGCCTGTGGT
TTTGTAGATTTCACTACTGCAGCCGTACCTAAATTGCACGTTTGCATCGAAATTCGTCTTATCTTGTTATTTCTTCTTCTATCAAACGGTCTATCTAAGC
AGTCTTAATTTTTTAACTTCAACATCAGCCAGTGGCAGTGCCATGGAGCTTGCTGCCCGCTCTCAGCTTAGATCTTGCTCGAAAGAACTGCAATCACGTG
GTCGACTTTTCTGTGTAGAGTAGAGTCAACGACGCAATACACACAAGCGCTGCCTGAAAGCTTCGCCACGATTAGCCGATGCTTTTGATCCTTGAGCGTA
GCGTAAAGGCGCCAATATGATACTTTGAAGTATACCTATGTATAAACGGTAGAGATACTTACTCTACGGGGCGAGATACTAAATTGGGAATTGATGGTGC
TGTAGCTATCTTCTCCATCGAGTACATGTAGGAAATCATCTAGGTGTAGCGAATCTCCAACCTCGCAGCTTTGAATTGGTACGTGTGATCCTCACGTTGC
AACTTGCAATCTTGACAGGCCTTCGAGTTCTATCGTGCATTCGGACTGTTGCTCTAACCTCGGCGCACGTTGATTGATTACCATCAAGTGCGAACAGCGA
CGAGACCTTGAAGTTTTGATGCACCGGACAGCGCGGAGCTGGACGCACAACGAACCTAAGTATGATACGTGTGCGCGGTGTACGTGTGATATCGCGACCG
GAGACGATAAGCACGTTCTGTGCGTACCACAAAAATCATAGCCATAGTACGCGCCTTTCGAACTCGCCAGCTGATGGACATGCGAATCCGGCTCCGACCG
ACACTGCATGCCACGCATGTATCCAGGTGACTATCGCGGACTTGTATCTCGGGAAAGGCGCTACAAGCCTCGGGAAGTCACCTTGGACGCTAAGCTGCTC
AAGCCACGAGGTCTTCGAATCAAAGTCTCGTCTTCATGCTCTCTCGGTGCAGGAGCTATCGCGCCATGTGGAGGCATCGCCATTACGCTATGCTCGACTA
TGAGGTTTGTCTCTTTTCTGAAGCTCAGCGGGCGATCACCGGATGGGAGCACGACAAATCGGTCTGTTGGGTGTTCACCCTCGTGTGCCTCTAGACGGAG
CTGTGGATACTCCGCATCTTGCTGCTCGAACAAGGCCCTTTGTCGTGCTGTCCGAGAGTAGTTTGCGTCCACAGTCACTCACTTTTCAATTTACTTTGCT
TCGGACAAGCATCGTTCTCCACACCCCAGCACTCACCGCTGCTACCTCTTCACCCCTACCTCCTTCCTACTTCAAAGATGAACCTCACTAAGTTGGTTGC
ATACCTGGCCGTTGCGTCCTTGACCGTGGGCACCCTGGCCGATGCCTCCGTCCCCGCGGCTGGGCAAGCTGTTCGTCAGCTTGGAGCCGGGGGCGGTGTC
TCGACTTCGACGACGGCCGATACGGCGACGCAGCAGTCCTCGACCACCCAGACCGGTCAGACGTCCACAGATACGACTACCCAGAATGGCCAGACATCGA
CGAACAACGGAAACCAGGGTCAAACGTCTACGGTCAGCGGAAACCAGGGCGGTCAGACCTGGACCCAGGGCGGCGGCAACTCGGGTAACCAGGGCGGTCA
GTCGTGGGGCCAGGGCAACCAGGGCGGCGACTCGGCCACTACTCCGTGTCCCAGCGACAACACTAACCAGGGCGGTCAGGGCGGTCAGACCTGGACCCAG
GGCGGCGGCAACTCGGGTAACCAGGGCGGTCAGTCGTGGGGCCAGGGCAACCAGGGCAGGCGACTCGGCCACTACTCCGTGTCCCAGCGACAACACTAAC
CAGGGCGGTCAGGGCGGTCAGACCTGGACCCAGGGCGGCGGCAACTCGGGTAACCAGGGCGGTCAGTCGTGGGGCCAGGGCAACCAGGGAGGCGACTCGG
CCACTACTCCGTGTCCCAGCGACGACACTAACCAGGGCGGTCAGGGCGGTCAGACCTGGACCCAGGGCGGCGGCAACTCGGGTAACCAGGGCGGTCAGTC
GTGGGGCCAGGGCAACCAGGGCGGCGACTCGGCCACTACTCCGTGTCCCAGCGACGACACTAACCAGGGCGGCCAGGGCGGTCAGACCTGGACCCAGGGC
GGCGGCAACTCGGGTAACCAGGGTGGAAACTCGGCAGAAACTCCGTGCCCTGGTGGTGATAACGACTCGAACCAGTGGACTGGCACCGTAAGCACACCAA
CTCAAGGTTCTACTGGTGGTGACCAGACCCCTCCTGCGACTACGGGTGGTGACTCGGGCGAAACGCCGAATGGCCAGGGCTCTGCTGGTACGCCTACTAC
GGAAGCTCCGGCTACTGAGGCTCCCGCTACTGAGGCACCTGTCACGGAGGCGCCAGCTACTGAGGCCCCTGCCACTGAGGCCCCAACAACCGAAGCCCCA
GTTGCAACGACCAACGCGCCAGTGAGCAAGACTGGCATCACGACCACCACCCAGTCGGATGACTCGACCACCCAGCAGTCTGCCACTCAATCCCGCCTTC
GCCACTAGGCGGCTATGGTAGCTTTTGGCCTCTCTGTCACAGAGCCTGTGGCCTTGCCTGTAACCCCTGTTTCGTAAATACACGCCTGCTTCGCTTTGAC
GACAGAGCAGCTTGTCAAGCTTGATCGATTCGGCGATGGCCTCTTTAGAACAGTCTCACCGTCACCGTGCAGTAACACACGTTGAATTTGATCGCAGCGG
CTACTGCAACCTAAGGTCTTTCGTACACATACATGTACTGTACTCCTACTCTTGGTTGTGAACTATTGAATATGAATGATGAAGTTCTCGGGGTGCTGCG
CATTGCTTCTATCGATGCAAGGGCCTCGGCATGATTCCAGCGGATTTTTTCGTTTTGGCGGATTGGCCAATCCGCCGTTGCGTTTGCAGTACTGTGACTG
CCCGATCGGTTGCCTTTGGGTGTCTTCTTGAGTTTTTATCATCGTGTAGACGTTTAGTAAAAAAAAAAAAAAGGGATACTGCAGCAAGCTTCTTGAACAA
GCACACACCAAATTCTAGTTAATACTACTAAATTTCACGATGAAATTCTGCGGATAGCGGAGTGCTAGTTCTTGTACTGCACCACAGACAGCAGATTGAT
CAACCCGCAGGATGGAATTCGTCCGCTGGAAGGTGATTTCCAATGGATTGAAACAGCGGAACTGCAGTACAGGCCTTAAGTTCTCCACCAGTAAAACTTT
AGTGCATCGCTCTGCTGCGGTGCTCCTCAGACAAGCCACCTCCGCAGGAAATTTCCTGGAGTCAATCATTTCCTTGAGTCAATCACGCATGCAATGGCTG
CTACCGCAAAAAACAACCGCCTCAAATCCTGGAAACTGAAAACTCAAAGTGCCCCAGGGAAATCGACGCCCTGATTTCCCTTCGAATCAAAATGTGGCTG
GTATCATCGTAAATAGAAATCCTCAGCTTAAATTGCCGTAGTTTGTCGTCCGAGGTAGAAAATGCGATTTACCTCGGCTTCTGCCTGTCGCAACCCCTAA
CCTTTTCCAAGGTCATACAAAAAGGTGATACCGCCGCAATCTACACTTGCGGATACTGCATCCCTGTTATAGAGACAACCTTCCGTTTTGCCGCTTTTGA
ACGGTATAAATGAGTGGCATACTAGCTTCAGCCCGCCACCAACACTGCACAACTGCTCCAAGATAGAGTGACCTATCCCTATTGAAGGCCCGAATTGTAA
AACGGGCCCCTCCGAGATGCGGAGCTATACCAGGCGGCAAAGAGGTTGAAAAGCACTATGCCGCAAGCCTAGCGGCTGGGCACATCTTCAAGAGCCCAGT
CCGGCTCTGTTGTGCTGTTCGTGAGTCAGGAATGGCCGTCGCCCTCACTCCCCAATTTACTTTGCGAGCTGTGTCTTTTTCCGAGATGAACCCCATCAAG
CTCCTCACGCCGCTACTCGTCATGGAGCTAGCTGTTGTCTTCGTCGCAGCAACCCCCGGCGCAACCCCCACCCCTGTGAATGGTCCGATTTACTACGGCC
GTCCCAACAACGGTGGCTATCCCTACACTACTCCTCCGCCAGTCGCCACGAAGCTCAGCAAAAATGAGACTGAGACGCCCACCCCCGTGAATGGTCCGAT
TTACTACGGCCGTCCCAACAACGGTGGCTATCCCTACACTACTCCTCCGCCAGTCGCCACGAAGCCCAGCAAAAATGAGACTGAGACGCCCACCCCCGTG
AATGGTCCGATTTACTACGGCCGTCCCAACAACGGTGGCTATCCCTACACTACTCCTCCACCAGTCGCCACGAAGCCCAGTAAAAATGAGACTGAGACGC
CCACCCCCGTGAATGGTCCGATTTACTACGGCCGTCCCAACAACGGTGGCTATCCCTACACTGCACCAACGCCGCAGACCATCAAAGAAAATTAAACGTC
GTCGTGCAAGACCCAGCTAGATGCAGGCTTCATACCTGGGCTCGAGGGTAATTCAGACACCCG