Description :
From Genome Similarity Track
Location :
Scaffold_1300:3864- 7726
Transcript NameFunction/comments
Phypl_g13044hypothetical protein

Sequence
3862 bases(100 bases per row)
CCCCTCGGTTGAACTCGTACAACAATGCACCGCAGCTGAGTTGCGATACCGGAGTCCAATCAGGGTCATCGTAACCCGTCCACTTCACGAGGTAATCTTG
GGTACGTTTGGACGTCCGTGTTCGTTTGACCCATCGCAAATCCAGGATCTTCTCCACTTCGTACTCATTGTTGACATTGTCCGGTCCCAACTATCTTCGG
GCGACAACGCAGTGTCGAaatcgccatcttcgtccaGATTCAGTTCAATGGCGGGTCGGTAGCTCTCGGCTTGAGCCTGCTGACGTGTACCCAAGGATTC
ACACGGTATCCCGTGTCCGCAACCTTAAGTTTCACCCGGAAGTCATCCCGAATTTTATCAATCCGGAATGGTCCATGCCAAAGGTGTGCTAACTTCCGGC
TCAATCCAGGCTGTACCTTCGGGATGAACAGCCACACCGCATCACCCTTCTCGAATCCTGACCTGAGTCGTTCCGAGAGTTCCCGCCACTTTCTGGTCTG
TTCTTCCGTGCGAGCAcacttcgccttcttctgcaggTCTTCGGCGCACGCCTGAGCATAACTGTAATCACGCTGGAACTTGCGACGCCATACGTAAGCT
GTTCGCTCAGGGAGACTGGAGGGCTTTGGTCCTAACATGGCTGACACCCTTTCTTGGGCATCCCAACCGTGAACGAGATAGAAGGGAGTATCTAGACGGG
TCGCATCGAACGACGTATTCAGGGCGACCATTAACCTTTCGGCATGGTCGTCCCAATCCGTCTGGTCTGCTTCCGCGATGTACGCCTTGACACTTCGCAT
CACGGTCTGAACTGACCGTTTTTGCTGGCCATTCGCCTGGGGCCAGTATGCCAGAGTGGCTCTCTGCTTACTGACCAGCAACTCTCTGAATCGCGTGAAC
ACTTCGCTCATGAATGTAGGATCCTGATCGTGCGTTATCATCGACGATGCTCCAAACCTCCTGAACACACTTTCTTCGTACGCTTCGGCCACATCCTGAG
CAGTCGTTGAGGACATTGGCTTGCACATGACAAACCCAGAGAACGCATCCTGAAATAGGAGCAGAAATGTGTTCCCTCGGGCTGACTTCGGCATGTGCGT
CACAAAATCCATAGAGACCGTCGTCGCGGCTCGATGTTGCCGGGTGACGGCCCTGGATTGGGGGGTCGCCCTTTGCCACTAGCGCAGTCGACGCACTCCT
TCACGAAACGTTCGACATCTGCATACATGCCGGCCCAGTAGACCTCTGAGCGTAGCTTCTCGTGGGTCCGGGTAATGCCTTGATGTCCACCTTGGTAATC
TTCGTGCGCATAATGCAACATGTCATCCCGAAGTGAGGTCGTGACAACTAGCCTGAGCTCGTCTGTCGCATCGCGAGGGCGATCCCGAGTGGAGCGTGCA
AGCCGATAGGGACGCCCCTGGCATCCAGGGCGAACAAGTCCGCGGTCTTGGCGATCTTCCTGAGGCGCCTTGGAGAATAATCATCCAATTCACCATTCAG
GAACGCTTTGATCTCCGACAAATATTCGTCCTGTTCCTGATGTACCTTAATTCGACGCCACCTCTCGGCTTGAAACTCAAGTGGCCCCATCGGTGGGCCA
TCATCCGGAGTGTCCCTCGCATTGGCCCTGGTTAGGACTGCCATCACTTCGGCTGCAGGAGAGAGAGGTGCCGTTTTTGGACCTAGGAAGGGACCTCAGG
ATCAGCCTTAGGCAGAGTACCGGAGTCTCCCTCATTTTCGTCACCACTCTTCTCTTCCTGAATCACCACCGGGGACTTCACCAGTTGTTCATGGATCTTT
GACACTGGTTCCAGGTGTTTCCTTTCAGCTACATCCTGGACCATCCAGGACTTCCCCAACGCTAGCGTTTTAGAACTCAGGTAATCCGCGGCTTGGTTGT
ACGCACGCTTGACATGTACCAGCCTGACGGTCCTGAAACGGTCCTTCAGCACTTCATATTCGGCTAGTCGGCGTTGCAGATTCGGCTGATTGCAATTGAT
CAACCCTTGGACTTGCTGAATAGCGATCCTCGAGTCACCAACAACCACCAGGTCCTGAATACCTCGTTCGAGAGTCATAGTCATGCCTTTCAGCATGCCG
TAATACTCATCATCATTCACCGTGACTCCGTCCAGAATATATCACCGTGCATCCAGAACCCTCACAGTATACAACCGCAACTGCCCTGTTTTTTGGAGGT
CTTGGCTGCACCGTCAAAACTCAGGACAACCCCAGAGTATTCAacctccagcatctcgatACTCACGACAGGAGGAGCTTTCACGCGCCCCTTGACCGGA
ATTAGAGATTGGCGACCTCATCCAGGTGTTCTCTCGGTGTGATGCCAGCGCCTAGGATGGCTGCGAGCCCATCTTTATCTCGCTGAACCTTTCGGATCTC
CAAATCGTAATGAGACAACGCAACTCCCCAAGGTACGGTGTGTCCATCCGCAGTCTTTGACTTGATCGCCCATTTGAGAACAGAGTACCGGGTGTACACC
ACAAGAGGGCACCCCTCGACCAGAGTCCTGAAGACTTGGAGCACTCGAATCACAGCGATGACTTCCTTCTCGGCGATGTGATACCAAAGTTCTGCGCCAT
TCAGGACGCGCCCCGTGAATCTCACCGGCTGAATGCGACCATCATGTTCCTGCGCAAGAACAGCGCAAGCTGCCCACTGGTTAGCATGTGGTATGATCAC
AAACGGCTTGGTTCGATCTGGGTGTCGAAGCATCGGGGTGGAAGCAATCTTCCTTTTCAGGATACCGAAAGCTTCTTTCGCCCGAGTTAGGTCCCTACCG
GCCCGAATTTGTTCGTCCGTCAGCTCATAGAGGACTGCGGCAACAACAGGGAAATCCTCGATAAACTTGTGGTCGTAATTGAGGTTGCCCGAGAACGACT
GGACTCCCTTCAGGGTGGATGGGAACGGTAGCTCCTGGATCCCTTTGGCGATCTTCGGAGTAGCTCGAATTCCTTCGGCACCTATTTCATGGGACAGATA
CGGGATAACTCGCTTCCCGAATTCACTCTTGGGCAAGTTCACCGAGATATTCCAGTAACGCAGCCTGAaaagcagcgcgtccagaTCATCACATAATTGC
TCCCAGGTAGCTGCTCCATACGCGATATCATCGATGTAGGAACAACGACCTAGGACAGGACCCATTTGAGGTGGAGCTGGGATGTTACGCTTGAAGGCCG
TCATTTGCTCTGTCAGCACCGATAGACGCTGTCCCGAATGTACTTCGTCTGAACCACTCAGATGTCGTGGCTCGTAGGGATCCAATTTCAGGTAGTCCAG
AACTTCTTGGTCCacaagcgcttcttcctcagGAGGCAATCGAACAAAAACCCACAGACAGTTGTTGATCACGTTCTGGTAGATCAGCGGCGCGTTCTTC
AACCCAAATGGCATTCGAACCCACTGGAAGTGTCCGAATGGACAGACAAATGCTGAGATCATCTTGGCTCTCTCTGCCATCCGGACTGCCCAAAATCCAC
TGGCCATGTCTAGGCTCATGAACCACATAGCTTTTTCGAAGCCGATCAGCAGGTCATCAATCAGGGGAAGTGGGTAGTTGGAAAGCTGAATAAAACCATT
CACAACGCGATAATCGATGCACATCCTGATATccttgccgttcttcttgaggatAATCACAATTGGCGAAGCCCACGGAGATTCGGAGTGTTCAACCAGT
CCAGTCTCCAGAAGTTTCTTCAGCAACTCATACACTTTGACCATCAGGTGTGGGGCGATAGATCGAGGACGCTGAGCAACAGGCCTAGCGTCACCGACGT
CCAAATCACACACCAcaccacgagctggcgcaggagccgCATTCCCATGACCAAGGAAGATA