Description :
From Genome Similarity Track
Location :
Scaffold_2045:3864- 5206
Sequence
1342 bases(100 bases per row)
TCACCCTTAACGTCCTGACGATCGAAGCAGCCACGCCAACGTCGAGAGTCGAgtcaagttcttcatcgaCTTGCCCGCTAGCATAGAGTAGCCGACATCC
AGCATATGCAGTATAGTCAGCACTTCATTTTTCCATCACACCATAGTTCAGCTCGTTCTGCTTCAAAGTCCGGCTCGCAAACGAAACAGGGAAGTACGTG
CCTTCGTGATCCTTCACCACGGAAGCCGAGATAGTGCATTCGCTTGCATACACGATCACCACTGGTTGCTTCTCAGGACCAAAGTGCTTGTGGATCGGGG
CCGTCGCGATCTTGGATTCAAGGCCGTAAAGACGGCTTCCGCATGAGCCCACTTCTGATATGGTTCTGATTCCGCCGGACCCTCATCAGTCTTGATCGCG
GTTGACTGGATCCTGTTTCGGGTTCTGATCTCAGCAAAGTCCAACTCTCTCAACTCGTACAGGACACTAGTATATACCGCTAGATCCTCGGTGAAACATC
CATAGTAATTCAGACTGCCTAGAAATGACTGCATTGCGCGAAGGGATCGAGGAAAAGGAAGATCTACCAGACATACTAGATCCTTCGGGTGAGCTCCCAA
ACCTACCCCTAAAATCTGGTGACCCAAATAATCCACCGTGCGCAGTCTCTAAAACCACTTGGCCTCACTAATCGAAAAAAATCAACTTGTCATAAATGCT
TCCAACAGTAATTCCACACGCTCACATAGGTGATCCAGGATCCTGCTGTCACCAAaatgtcgtcgatgtagGATCGGCGGCTGAGTACTGGTGACTTGCC
AGGTTTCTCCGGTTCTCCGATCTCGAAAAGGTCAGCGAGGATCCTCCAAAGTTGGATGGTGGGATCCTCAGGAAACAGTGCAATGAGTTGTCCAGTAGAG
GTTGGTAGATTTGCGGGGAGTTCTTGAGTCCAAACGGCATGCGGTTCCGCTCAAACATCTCAAAGCGCGTAATGGATGCCGATAGCGCTCGAGCGCGGTC
CGTCATGGACACCACCCAAAAGCCGCTTGCCATATCCAACGAACAATCCCACCGCAATTTATCTAGCTCCTCAAGCAGATCATTGCTCAAAGACATATGA
TAAACCATCAGTCGCGTTAAGCTGTTGACCAAACGATAACCAATACATGCCTAGTATCCAcgctgttcttcttgataCTGATGTCAATCGGAGATGCCCA
CGAGGGAGTGGACGTCTAGATGATCTTGGCGGACAGCAATCCCTTGATCAACTCTGACAACTTCACTCAGAACTGGGGGCACCTTGCTTACACACTGTGC
AACTGGATTTGCATCACCGACGTCGATTTTACAAACAGAACC