Description :
From Genome Similarity Track
Location :
Scaffold_235:38633- 42285
Sequence
3652 bases(100 bases per row)
TGCATAGATTCGAACCGATTATGACTCGTCCGCTTGCGTTCAAACTCTCGAATTAAGGCTCCACAATTCAAATCAAGTTCACCATGTGTGGATGAACTTG
ATTAGGGGTCTTCGTACCCATTCCAACGAACAAGAAAATCTCGTTGCTGTCGCCCATACCGTATTTTCTTACCAGTACGGCTCTCCAAAATCTCCTCGAC
CTCGTATTCACCCTCTTCCAATTCTCGTACTCAACTGTCTTCCAGCAGTAGGCAATCGTCAAAGTCAACCCGATCTGCTTGGTTAAGTGCTAACTCGTTG
TCTGTTCGATCAGGGAATTTCCTGAACCGCTTGAGCTTGAACATGTGTACAATCAGGAACACTCGGTATTCTCGTACCACGGGTTTTCAAACATACTACA
TGGTCTTCCACCGGCTTCAAAACGCAGAAAGGTCCATGCCAAATATCATCCAGTATCCTGGCATAACCTTCTTTTACCCAGTCAAGAAAGAGCTACACTT
GGGTTCCCGGTCTAATTTTGTGGTCGACCACCCCTTCGTTCTGCAATTGCACTCGCATCTGACTCGCCTCTCGCACTTTCTCATTCACCTACTCTCTTGC
TCGCTGGTACTGGATCTGAATGCGGTACCTTCACCTTCTGGGTTCAGATTCCTGACGTCGGACGTTCACTGTCGGTAAAATGGCTTCAAGGGTGGACCTG
GCATCCCAACCGTGGACCAAATAAAAAGTCGTTTCTTTTCGTACCCGGTCCTGTGCGGTATTGATCTCAAGCGTAAACAGATTTGAGTACTCGTCCCAGT
CCGGATGCCCTACGTCCGCAACAAGATCCGGTTGGAGTCTGGATCATCCTCTCCGCCGTACCATTAGATTGGGGTCGGTAGGCTATTGTCGCTTGCTGAC
GTTGACCCGCCATACGGATAAACGCTAGGAAGAAATCCAACATAAATCCTGGTTCTCGATCATGACGGATCGCCTCTCTAGCCCCAAAACGACGGAAAAC
GCACTCTTCATATCCCTCATCGACCATCTGAGCTGTCCGTGACACGCTAGCCTTGGCCATTACATATCCGGTCAATAGATCAACCCATATCAGAAGTTCT
ACAAATCCTTTATACAACTTAAAGAGAGATGGAATATGGTCCATTGCTATAACTTGGAAAGGATAAGTCGCTTCGATACTCCCAGCGCTCCTCCCTTGTA
GGGTAGGTCCGCCTTTTCCAGTCCCGCAATCTATGCAAGAACCCACATATCTCTGCACGCTCCGAAACATACCTTTCCAGTGACAGAACCGTCGTATGCG
TTGGTAGGTACACCCAATTCCTGGATGACCCCCTTTTAAACTCTTATGGTAGTGGTGGAGAAAGTCAGTCTGGAGACTTTCCGGTACCACCAATCTGACC
GTCGTGTCACGGCCTTCTCCCTCGACTCTAGCGTTTGGACAATATACCAACAATCCTTCCTCGCTTACATATAATATTCGTACATTTTGCCGCACTTTTT
AGCGGATTCCACCGACAGGTCATTCCAGTCTCCTTTCCGATATGCCTTCAAATCTCGTACTCAGCTCTCTTCTTCTTGCGCCTTTCGAATTCGGTCCACG
CGGAGTCGCTGTACTACCTTCTCTTGCATAATCTCTCCAGATATCCTGATAAAAGACCGCGACCGAATTACCGCAAATATTTTGGTCGAGATGTTTAGTT
CTTTAGAAATTAGCAGCTCCGCTAGACGATTGATTGCATCCAAGCCTGGTCTTTCTTCGCCCGGCACCGAATTGATCCTCCCGTTTTGGTGCAAGGCGGT
ACTAGCCAACTGATCTGCGCTCTGGTTCCAATCTTGTTTCACGTGCAGGATCCGGTGAGAAGGTCACGATTGGAGTTCGTTTAAAGCCCGGGATAGTAGA
GGTGATAGACCCGAGGTCTTACACTCAATCTCCCCTCAAATCTGCCACACCACTAAGTTGGAATCTCCACAAATAGTCAACCTTCGCCGCTACAAAGGTT
TCAACAAGCTAAATCCCAGCAACATACCCTCATATTCCGTAGATGTATCGAGATATTTGGAGGCGGATTCGACTATGATCCAAGTCGGGAGTCTCCATAC
GATAGCGCTACACCCCCTTGCTTGACACGGACTGACCCATCGAAACTCATTACTATAGTTCTTCGTTTAATTCCACGGTGGGGGTGGGTAGGTCGATAGT
CTGCCTCGTCTGCTTCTTAGGGGCAATGGCGACCATATTGAGTCTACACTCTCTCTCGAGGGGTGACACTGGCTGACAACGACCCCCAGCACCTGGTCTT
CACCTTCTTTACACTTCACGATCTCCAAAGTCCACTGAGACACTAGAGAGGCCCAGTTTCCTAAGCGTCCCTGCAAGCCGGTAGACTTTACCAACCATGC
CAATGTCGGGTGTATTGTCAAGACTTTGAGGGGCTGAGTGACTAGCATAATGAAGCAGGTCTCCAGTATATGCAATAGGGACAACACCTCTTTCTCCACA
GTACTGTAATTTATTTCGTTAGCCTTGAGGGTTTTGCTTGTAAAGGTTACCGGCATGAGCAATCCTCCATAATCCTGTAGCAGTGACGTCGAATGGCCCA
TTCACTCGCATAGACAATAATCACGGCTTCTCTTGTTGGGTCGAAGTGTCTCAGAATTGGCGCCGTGGCAATTTTATTCTTGAGCATGGCAAAGGCTATT
TGAGCGCGGGTCCACCTTTCTTCTTTTTCATCCTTAATGGTGGCATTATTATCTCCCTTCAACTGGTTTCGTCGGGCATGAAAGTCCACTTCTCTCAGCT
CGTAGAGAATGGATGCTTACACGGCGTAGTCCTGAATAAACCTGATATAGTAATTTAAGCTTCCCAGAAAAGGTGGCATGGACTTCAGTGTCATTGGTAA
GGGTAGGTCGACCTGAGATTGAGGTCTTTCGGGTGAGCCTCTAGCCCTCCACTAGATACTTGATGTCCAAGGTAGTCGACCTTCCGACATCCCCACGAGC
TCTTGACTGCACTGATCAACAAGTTCCAGTAGTCGCACACATCAAACAACCGTTCCACATTTGTTCACAACGCATCCCATGATTCTGCGGGGATCAGAAT
GTCATCTATATATGACCGTCGACCCGGGATCGAGGAAGTCAACTTCTCATCTAGTTCTCCCACCTTGAACAAATCCTCGGACCCATCTGTCTCCGCTTCT
GGGGGATTCGTAAAAAACCATATAAAGCGTTATCTAGGAGTCTTTGATATATTTGGGGCGCGTTCTTGAGCCCAAACGGCATCCGCATCCATTCAAACAA
ACCCAGTTGGGTAATGAACGCCGAAATTCGTCTCGCCTTATCAGTCGTACCGACTACCCAAAAACCTCTCGCCATATCCAATGAGCAATACGATAATGCC
TTATTCTGGTCTTCCAATAGGTCATTAATCAGAGGCATGGGGTAAACCATAAAGTTGAGTCAGGTCGTTCACCAACCTGTAGTTGATGCATAGCCTGATG
TCCACCCCATTTTTCTTCACAATGATAACGATTGGGCTGGTCCAGGGTGACGTCGAAGGCTGTATATTCTTTACAGATAACAGCCCCTTAATCAGATCGG
CCAACTTCTCCTTAAATTGAGTGTCCACGTTACGTGCACGTTGCGCGATCGG