Description :
From Genome Similarity Track
Location :
Scaffold_29:38632- 42621
Transcript NameFunction/comments
Physo_133937hypothetical protein

Sequence
3989 bases(100 bases per row)
CGGATGGTGTTGAACAATTTCTGCTTGATGACGACGGAGGCCAAGTGATGAACGACATTCCTTGGTGGACCACGATCCCGCACTACCTGCTGGTATCGCT
ACCCGGTGTGCTGATCTGCATTCCGAGCTACGACCTGAACTATTCGGAGGTCCCGCAGAGCATGCGCAGCACTTCGATCGCACTCGCGTTCTTCGTCAAC
TCAATGGGCAGCTCCTTGTTATCTATCATTGTGTGCTCTTTGGCAAGTACATCCCGGCCAATCTCAACAATGCACATCTGGAGTATCTGTTCTTCACTCT
CGGCGCGCTTATGATCGTTAATATCTTCTTTTATGTAGTCGTCATGAACCGGATGAAGTTTGGGACGAATAGCAGGTGCAGGAGTCCAGCACTGCTTAAA
GAATACACTCTTTCTGTTTTTCTCACTCAACATTTCCCAGCATTATGCTGCATTTCTTGGTTTACTAGCTAAGCACTTAATCATGTTTTCGATTTCTCGC
AGGACGTAGAGTCTTCTGATTTGGTTCAGTAGACTCTACCAGAGGCGGCAAGACCTACAGTAGAGTCTACTAACTGCCCAGTGAAAATTAACTAGTATCC
ATTACTGTACAGACAACGACGATGAAATACGTCACCATTGGTCTAACCTGCACATTTGCACATTTGATGGCGCCTTTTGTAATGGTTGTTGTCTGACTGT
ACTGTAGATAGATTCGAATACAATAATCCAATAATTTACTGTAGACACAACCCATACCATCCGAACTACATGTAGATCACTTTGACCGTCAAAACACCTG
AACGTAAATCGAACGGGACACTGAACTAGCACGATATTTCGAGGTGAGTTAGCGAACTATGTTGAACATGTAGTCGCCACAGGGTCGGCCTGGTCGACTC
GACTAGACCACAATAGATCATCCTAAAGACACGCTTACAACACGCAGCAGCAGCAGGAAAAAATCAGTCAATCGAGACGAATGCCCGTGCCCGGCTCACC
GATAGGCGTCGACGAAAGAACCAGGTCGCAATGCATTGGTGTGTCGATCTAGCGGCCCGCCCAGTGCATCGCGCGTAGTGGATCACGCAGGACTGCTTGG
AGGTCCATTCTTCCCGTTGAAATGCTTTCTGCATAGCCGGGCTTTGTGTGTGGTTGAGAACCGCCCGCACGATTTGCACAAGTTGAAGCGATTGATTGTG
CCTACTCATCCTGGACACCGACCCTGGGCAATAGGGCACGCTCACTGGAGACCCGCGCAGCCAATGCAGCAGCGCTCCCGGCCAAAGTGTCCCGTGCTAA
GCGATCCGCTTTGCCTAATTGGAGGCTGGTGCTCCGGGTCAGTGGCCCATCGTAAATAATGACAGGACTCAACCAAAACGTTGCAACTGCGTGCCCGGCC
AAAACGCGATACTCGAGCACGTTAGTAAGCAGAGGCCCCTCCTCGTGAAGCCCGGCTACTTGCATCTAACACTATCGATACCTAAGTGCACGGCAAGCGG
CTCCTTTGCTCCAACGACCAAAACTCAATTTCCGCTCTTGGAAACGACATGGGCAAGAGCAATCCGCCACAGTCCCCACTGCCGACCCCGCAGTCGCTGA
CGCCCGTCGTCACCGCCGGCTACAGCACCAAGCTATGGGATGCCAGGGCCCCCAAGTATTCCAAGAACGTCATGAGGAGCGTCTGCATCTTCCTCTGCGT
CGTGACGTTCTGTGAAGAGCTCGCCGGCTGCGGCGTCAACCAGTCGCTCAAGAACTTCTTCCAGAAGCTCGAGTGGTCCAACAAAGGCTCCAACTCCATG
AAGCTCACGTACGACTCGCTCAGCCAGTTCGCTTGTATCGCCGCGGCGTTCATCGCAGACCAGTACCTGGGAAAGTACAGGACGCTGCTTGGCGCGACCT
CATTCAGCCCGCTCGGCTTCGTGCTGATCATGATCGCAGCCTTGCCGTCCGTCCTGGAGAACCAAATGTTGAACAAGGTGCTCTTCTGCGTCGGCCTCTT
CCTGGGTATCGCACTGAATCAAGTTGGCATGAGTTCGCTGTTGGTATCATTCGGCGGCGACCAGTTCTCCCCGGCGTCTCCTCCTGAGCAGCGAGCGTCG
TACTTCAGCATCAACTACTGGTCATCAAACTTGGGTGTCGCTATCAACTACGCGGTGTTTCCGTCGCTGTGTCTGAACGGCGTTGGAGCCATCCCCGCGG
ACTACGGATACGTCGCCGTCTTCGCTATCGGCTTGGCGCTAATGCTGTCAATCATCGCGAACTTGATTGCTACCCGCCGTCGCTACATCCACGTCCCTCC
CACGAAGAGCGCGCTTGGAAGTGTGATCCATGTGGTGGTCTGTAGCTGCAAGCACAGCTTCAGTGCGAAAATGATTGTACTTGGCGCGATCCTGTACTTG
GCCGCGTTGTTCCTCAACATCCTTGCGGCATTCATGTCGGATGATGGCGAGACCGGCCATCGCATCTCATACGTCTGTGGCGCTCTCATCGTTGTAGCTA
CCGTCCTTTGGATCTACTTCGGACAAGATGTATCCATGGTCGGTAACCGGATTTTTAGGTCAATCCTACATTTTGGTCACGGGTCAAATCCTTACTTTGG
TCACGTGACCTAAGCGAATGAGGTCACATGTAATTCGCAAACGGTTTGGTTGTTAAGTAAATGCGTTATAGCGATTCTGCTCCTGACAGATAGCGACTTC
CGCACCATTATTCCGCGCTGTCGTAGTCAAAAGAGTCGTCTGGACGATAGTCTGCTGTTTCATGATCCATCTCGGCATCGTCGGCCTCTAGCACTAGAGC
AAGATTCAGGGTCATCAGTGGCGATGGTAGGCTGCTCTCATAAGTCTTTGCTCTTCTCTGACCCCACAATGTCGGCGGCCTGACGCAGTTGAGGCGCACT
CGGCAGCTGGAGACGTTTCCGCCGAGGAGGCCTACCGGGTACCGAGCCTGGAATGGATAACAACGCGCGGTGCCGCATATACGTGAGAAATACCTTTTCG
TGACCTACATTACGCGATGGGGGCCGTCTCATGTTGAAGTGTGCTGAGCTGTGATGCGATGGGTTAGCTACTGTTCTAGGCGCGTATAATTTTTCTAAGT
GAATGCTACAAAGCACGAAATAGAATCCGGAGACGATGTCGAAATTTCATAATGGGTTCCTTATGTCGACGAAGTTGTTCATGGGAGGGTGTGTAACCCT
ACAGTCTACTTGTACTACCATGTCGCACTATACGAGCCGGTTGCCTCGCTATTACACTGTGTACTTTGCAATAGTTGAGTTGCGTTATTGTGTAGAATGA
AAGCTAGGTGCAATTCTGTATGGTAGGCGGCTCAAAATATAGCATGGTACTACTAGCAGTGAAATATGGTAGGCAAATACATGATAAGTGCAGTGGAGGT
TTCCACAGAAGCGAGCCCAGCCCACTCATCGGGAGGCTTACGCTACAAAGCGGGCAGGAGGAAAGGGAGGAACAGCGAAACCAATGCGAACGACAGAGAG
AGAGGGGGGTCGGTTTGGTAGAAGACGCTGGCAGAAGGCGCTAGCAGGAGTCAGCTGAAACACATACACAGATTACTTTGAAATCAACCTTTTAAGCTAA
ACAGAGCTTTGGTTTGCTCGGAGCGCTAGCCTCCCTGGTCCTTTATAATAGTGTTCCGAAACCTACTTACAGCTCTGACTCTTCGCTACAAATACAGTCG
TTATGCCTCCGAGACGGCCGAGTCGCGAGGATCTCCCCCGCTTACCGTCGCGGTGGACAACAGTGCTCGCGTCCCTCCAAACCGAAGCTGGACGCTGGAT
GGACCACCGGACCTTCACCCTCACTGGCACACCGTAGCAAGTGTGCATATGCTGTCACCTTGCAAGGTAGGCAGAGTGAATTGTAAGCGCTGGAGGATCG
GGCATTTGCTAAGCCGTTAGTTAGGCTAAATGACTGTAATGCGCCGCACCTTGAAACGAAACGAGACGGCGAGTCGAGTGTGCGGTCAA