Description :
From Genome Similarity Track
Location :
Scaffold_235:38632- 42306
Sequence
3674 bases(100 bases per row)
CTGCATAGATTCGAACCGATTATGACTCGTCCGCTTGCGTTCAAACTCTCGAATTAAGGCTCCACAATTCAAATCAAGTTCACCATGTGTGGATGAACTT
GATTAGGGGTCTTCGTACCCATTCCAACGAACAAGAAAATCTCGTTGCTGTCGCCCATACCGTATTTTCTTACCAGTACGGCTCTCCAAAATCTCCTCGA
CCTCGTATTCACCCTCTTCCAATTCTCGTACTCAACTGTCTTCCAGCAGTAGGCAATCGTCAAAGTCAACCCGATCTGCTTGGTTAAGTGCTAACTCGTT
GTCTGTTCGATCAGGGAATTTCCTGAACCGCTTGAGCTTGAACATGTGTACAATCAGGAACACTCGGTATTCTCGTACCACGGGTTTTCAAACATACTAC
ATGGTCTTCCACCGGCTTCAAAACGCAGAAAGGTCCATGCCAAATATCATCCAGTATCCTGGCATAACCTTCTTTTACCCAGTCAAGAAAGAGCTACACT
TGGGTTCCCGGTCTAATTTTGTGGTCGACCACCCCTTCGTTCTGCAATTGCACTCGCATCTGACTCGCCTCTCGCACTTTCTCATTCACCTACTCTCTTG
CTCGCTGGTACTGGATCTGAATGCGGTACCTTCACCTTCTGGGTTCAGATTCCTGACGTCGGACGTTCACTGTCGGTAAAATGGCTTCAAGGGTGGACCT
GGCATCCCAACCGTGGACCAAATAAAAAGTCGTTTCTTTTCGTACCCGGTCCTGTGCGGTATTGATCTCAAGCGTAAACAGATTTGAGTACTCGTCCCAG
TCCGGATGCCCTACGTCCGCAACAAGATCCGGTTGGAGTCTGGATCATCCTCTCCGCCGTACCATTAGATTGGGGTCGGTAGGCTATTGTCGCTTGCTGA
CGTTGACCCGCCATACGGATAAACGCTAGGAAGAAATCCAACATAAATCCTGGTTCTCGATCATGACGGATCGCCTCTCTAGCCCCAAAACGACGGAAAA
CGCACTCTTCATATCCCTCATCGACCATCTGAGCTGTCCGTGACACGCTAGCCTTGGCCATTACATATCCGGTCAATAGATCAACCCATATCAGAAGTTC
TACAAATCCTTTATACAACTTAAAGAGAGATGGAATATGGTCCATTGCTATAACTTGGAAAGGATAAGTCGCTTCGATACTCCCAGCGCTCCTCCCTTGT
AGGGTAGGTCCGCCTTTTCCAGTCCCGCAATCTATGCAAGAACCCACATATCTCTGCACGCTCCGAAACATACCTTTCCAGTGACAGAACCGTCGTATGC
GTTGGTAGGTACACCCAATTCCTGGATGACCCCCTTTTAAACTCTTATGGTAGTGGTGGAGAAAGTCAGTCTGGAGACTTTCCGGTACCACCAATCTGAC
CGTCGTGTCACGGCCTTCTCCCTCGACTCTAGCGTTTGGACAATATACCAACAATCCTTCCTCGCTTACATATAATATTCGTACATTTTGCCGCACTTTT
TAGCGGATTCCACCGACAGGTCATTCCAGTCTCCTTTCCGATATGCCTTCAAATCTCGTACTCAGCTCTCTTCTTCTTGCGCCTTTCGAATTCGGTCCAC
GCGGAGTCGCTGTACTACCTTCTCTTGCATAATCTCTCCAGATATCCTGATAAAAGACCGCGACCGAATTACCGCAAATATTTTGGTCGAGATGTTTAGT
TCTTTAGAAATTAGCAGCTCCGCTAGACGATTGATTGCATCCAAGCCTGGTCTTTCTTCGCCCGGCACCGAATTGATCCTCCCGTTTTGGTGCAAGGCGG
TACTAGCCAACTGATCTGCGCTCTGGTTCCAATCTTGTTTCACGTGCAGGATCCGGTGAGAAGGTCACGATTGGAGTTCGTTTAAAGCCCGGGATAGTAG
AGGTGATAGACCCGAGGTCTTACACTCAATCTCCCCTCAAATCTGCCACACCACTAAGTTGGAATCTCCACAAATAGTCAACCTTCGCCGCTACAAAGGT
TTCAACAAGCTAAATCCCAGCAACATACCCTCATATTCCGTAGATGTATCGAGATATTTGGAGGCGGATTCGACTATGATCCAAGTCGGGAGTCTCCATA
CGATAGCGCTACACCCCCTTGCTTGACACGGACTGACCCATCGAAACTCATTACTATAGTTCTTCGTTTAATTCCACGGTGGGGGTGGGTAGGTCGATAG
TCTGCCTCGTCTGCTTCTTAGGGGCAATGGCGACCATATTGAGTCTACACTCTCTCTCGAGGGGTGACACTGGCTGACAACGACCCCCAGCACCTGGTCT
TCACCTTCTTTACACTTCACGATCTCCAAAGTCCACTGAGACACTAGAGAGGCCCAGTTTCCTAAGCGTCCCTGCAAGCCGGTAGACTTTACCAACCATG
CCAATGTCGGGTGTATTGTCAAGACTTTGAGGGGCTGAGTGACTAGCATAATGAAGCAGGTCTCCAGTATATGCAATAGGGACAACACCTCTTTCTCCAC
AGTACTGTAATTTATTTCGTTAGCCTTGAGGGTTTTGCTTGTAAAGGTTACCGGCATGAGCAATCCTCCATAATCCTGTAGCAGTGACGTCGAATGGCCC
ATTCACTCGCATAGACAATAATCACGGCTTCTCTTGTTGGGTCGAAGTGTCTCAGAATTGGCGCCGTGGCAATTTTATTCTTGAGCATGGCAAAGGCTAT
TTGAGCGCGGGTCCACCTTTCTTCTTTTTCATCCTTAATGGTGGCATTATTATCTCCCTTCAACTGGTTTCGTCGGGCATGAAAGTCCACTTCTCTCAGC
TCGTAGAGAATGGATGCTTACACGGCGTAGTCCTGAATAAACCTGATATAGTAATTTAAGCTTCCCAGAAAAGGTGGCATGGACTTCAGTGTCATTGGTA
AGGGTAGGTCGACCTGAGATTGAGGTCTTTCGGGTGAGCCTCTAGCCCTCCACTAGATACTTGATGTCCAAGGTAGTCGACCTTCCGACATCCCCACGAG
CTCTTGACTGCACTGATCAACAAGTTCCAGTAGTCGCACACATCAAACAACCGTTCCACATTTGTTCACAACGCATCCCATGATTCTGCGGGGATCAGAA
TGTCATCTATATATGACCGTCGACCCGGGATCGAGGAAGTCAACTTCTCATCTAGTTCTCCCACCTTGAACAAATCCTCGGACCCATCTGTCTCCGCTTC
TGGGGGATTCGTAAAAAACCATATAAAGCGTTATCTAGGAGTCTTTGATATATTTGGGGCGCGTTCTTGAGCCCAAACGGCATCCGCATCCATTCAAACA
AACCCAGTTGGGTAATGAACGCCGAAATTCGTCTCGCCTTATCAGTCGTACCGACTACCCAAAAACCTCTCGCCATATCCAATGAGCAATACGATAATGC
CTTATTCTGGTCTTCCAATAGGTCATTAATCAGAGGCATGGGGTAAACCATAAAGTTGAGTCAGGTCGTTCACCAACCTGTAGTTGATGCATAGCCTGAT
GTCCACCCCATTTTTCTTCACAATGATAACGATTGGGCTGGTCCAGGGTGACGTCGAAGGCTGTATATTCTTTACAGATAACAGCCCCTTAATCAGATCG
GCCAACTTCTCCTTAAATTGAGTGTCCACGTTACGTGCACGTTGCGCGATCGGCTTTGCATTTCCTTTATCAAT