Description :
From Genome Similarity Track
Location :
contig_49:386316- 389247
Transcript NameFunction/comments
g9759.t1hypothetical protein
g9760.t1POM60725.1 PLK/PLK-UNCLASSIFIED protein Kinase [Phytophthora palmivora var. palmivora

Sequence
2931 bases(100 bases per row)
CCAGCAGGCCGCTGCCAGGCTGCTGGCTGGGGATGCGTTTCACGGTCACGCTCGTGTTCCTGGGCAGCTGCGTGGTCTCATCGTCGTAAACCTTGCCGTT
TTGCGCGTCGGTGATCACCAGGTCGAAGTCCAGGCCCTTGGCCAGCTTCTTTTTGTCCACGATGGCCTTCTTCAGGTCCAGCACGCGGATCACGGCGCCC
GGAAACGTCACCGTGTCGAACTCCTTGGCCGACTTGAACTTAAAGTGGATCGACATGGCCTGGAGTTGTAGGGGGGTCTAAAACGTGGCTACCGGCGCTG
GATGGGTCTACACACGCAGAGCTACGCGATGATCCCACTCCCGAGGCACAGATCGACGTGCGAGACGAGCTACGGCGACGAGGAGAAGCCGAATGATCCG
AGCGGGCCTGCCGCTTGTGTCGAGCGAAGAGCTGGTTGGTCAATGCGGACGGGGGGCCAAAAGCAAACGCGCAAACGTGGCATCCGATAACCTTTCATGT
AACATATACTACTGACAACCATTAAAACCAAACTGATACTAATATTGGACTTTATACTTACATACACTGTGTAACAGCATATTCGCGGTTCTATTCTCGA
GATCTTTGTCGGTGTGGCCTACCCCAATTACACGTGCGCCACATGTTCCCCCTTTTTCTGCGTACCACGGTACTTTTGAAACTTGAATTTTGAATATCTG
AACCGCCTCCATTCGCCTCCATCCCGGGTGGCCATGACCATGCAGGCGCGCGACCCGACGGAGCTGCTAGCGCCGGCCGGCGGCAAGGAGAACGCGGCAG
GCCGCGGCAATCAGGCGGCGACTTTGGCCATGCGCGCTAAGCGCCGCGGCAGCAGCAGCAGCAGCGATGCGGCCCGCCGCGTGTACGACAGCGACCGGTT
CAAGCTCGTGCAGAGTCGGCGGGGCAGCGGAGCCGCGGCCAGCCCCGGCCACGCGCCGGCCAGCAACCAGGACGAGCACACGGACGTGGCCCCACCCGTG
GCCGCCCAGCAGAAAAAGAAGGAGCCCACGCCGCAGCCTGTGGTGCCCGACCAGATCCTCGAGGCGTATCTGGACGCCGGCGGCTATGTCAAGACGCGCA
CGTACGTCAAGGGCAAGTTCCTGGGCAAGGTACGCTGCAATGCAGAGCTACCCTGTTCGTGAAGGTGCTAATTGGTGCTGGTTTCTTGTTGCAGGGAGGT
TTCGCACGCTGTTACGAGCTCAAATGTGAGCAGACTGGCAAGATTTACGCCGGCAAAGTGGTGGCCAAGGCGTCACTGGTGAAGCCCAAGGCCAAGCAGA
AAGTGAGAGCTCATGCGGAGGTGGTGTGAGATTGATGCTGATGATGTGTTGTACTTTTGGTGGTGGTGTCCTTTCTCGGTGATGTTGTACTTTAGTTCAC
GTCAGAGATCAAGATCCACAAGTCGCTCCACCACCCGCAGGTTGTGCAGTTTGAGCACTTTTTTGAAGACGCGGACAACGCGTACATTCTGCTGGAGCTG
TGTCGGAACCAGTCCATGTCGGACTTGATGCGGCGGCGGAAGAGGCTCTCGGAGAGCGAAGTGCGCTTCTACATGCGCCAGCTCGTGGACGGCCTGGCGT
ATCTGCACGAAAACCTCGTGATCCATCGCGACTTGAAGCTGGGCAATCTCTTCCTCACGTCGGACATGCGGCTCAAGATTGGAGACTTTGGACTCGCTAC
GCGGCTGGATAATCCAGAAGACCGCAAACGCACAATGTGCGGCACGCCCAACTACATCGCGCCGGAGATTCTGAGTGGTCAGCGGGGCGATGGACACAGT
TTTGAGGTGGATATCTGGTCGACGGGCGTTGTCATGTACACTTTGATCGTCGGGCGGCCACCGTTCGAGACGGACGACGTCAAGGCCACATACAAACGCA
TCCGTGCCAACCAGTACGACTTTCCAGAGACGGTGCAGGTATCAAAGTCAGCACAATCGCTCATTCGAGGCATCCTACGCAGTGATCCGGGTGCCCGACC
ATCGCTGGAGCAGATTTTGAAGCACCCGTTCCTGGCCGACGAGTTAATTCCGACCTCACTACCCAGAACAGCGCTGCTAGTTACGCCACCATCATGCAAA
ACCCAATCTTTCGCTAATCGTCACAGTGATAGTGAGCGCTTTGCAAATTCAACTGGTGTAAGAGTACCGCCACCTCCAGCAGCATCCAAAAGATATCCTC
TTCAGAGTCGAGACGTGAACAATCACACTCAACGCGCCTCCGATCCTGGGGCATCACCCATGGCCCAGTCGCTGCCTCCTGCTTATAAACGTGACGGCTC
TGGTCGGACCTCAGGATTGTCTAGCTCCGCTCGACGAAATCTAGCTGCAAGTAGCAGTACCGCGGCGGAGAGGTCTTCACACACAGGATCAGCGGAGATC
TTGGCTCCTTCTCAAAACGTATTGGAAGGGGCTTACAAGTCTCTGTCCCGGTTTTTCTTTCTTCAAGAGCACACTCACAGTGGAGATGAAGGCGACAAGA
GGCTGAGCGAGTCATCGTCTGCCGCTACGATTGTTGCTGCAGCACGAAAACTGAAGGAAATTCGCGCAGAGGCCGAAGAAATCCAGCCACTCATTCCTGC
AAGCCTGTGGATCTCTCAGTGGGTCGACTACACTTCCAAGTACGGCATCGGCTACATGCTCTCGAACGGTGGATCAGGTGTGTATTTCAACGACTCCACC
AAGATGATCTCCTCTGCAGATGGCCGAGCGTTCGAGTACATTGAGCGCCAAAGCAGTCAGAACCCAGGACCGGAGCATCGAGTCTGCTACACCCTGGAAA
ATTACAACCCGGCACTAAAGAAGAAGGTGACGCTACTTGGCCACTTCAAAGGCTACTTAGTAGACGCCCGCGCGGAGAATGACGAAGCCGACGCCCTTGA
AAACCAGCTCGCGCGGTCATTCGTGCTCTCG