Description :
From Genome Similarity Track
Location :
Scaffold_96:38631- 41317
Transcript NameFunction/comments
Hyaar_Emoy2809174hypothetical protein

Sequence
2686 bases(100 bases per row)
GCGTACGGGCAGTCCCAGAACAAGTGCGCCAATGTCTCCACTTCACCCCGACAGCCCGGTTGCTTACGACATGTAGCGAGTCGCCCTGCATGATGCAAAT
GGAGTAGCCTCGACGTGATCCGATATCCCGTCCAGACCTGATAAGCCGTAAAGTCTTTGCTATGGTCCCATACTTTCTTTAATGTTTGACATAGTGCAGC
GCGTTGCCATTCGTCCCGCCCTGCTCGTTCTTCCAGTCGGTCCAAGAAAATCCCCAAAGGGCGGGCCAATACTTTTTGTGAGTTCGAAAGGCTTAGATGG
CCCTATTCGGTGTTTTGTCAGGTAAATACCAAGGAAATTTGTGAAGGTGTGGGTGTGCTGCGAATACGAGGCCGCGTTCCTGTAGGTCGTGAATGAGCGC
CCTCTGCTCGACGTTTGATCCGACGGTCAGCTTCGGGATGGGTCCGGTACATCTCCAGTGCACGCCATCGTCCCCCTGGTTCAGCGTTATAGTCTGTGTT
GGGTCCTGCGCGTCATCCGATGTTTGACCTGCTATGATGCCTTCTCGTGTCAGTGACCATATATAGGTCGATAATGCCGGGGGAGCATGACATAATCGTG
GAGCTGAGTGCTGGCGTATGCTCTGTCCGACGGCTATAGTCGGCGAGGCTAGCAGCACCGCTGTTGAACATCTCTGTAATGTTGCTGCCGAGTGTGGCCT
GGGTGGGTTAGCTGACTGGGGTATCTTCAGAAAAATATCCGCTGGTCCCGTACGTTCCAGGCCAAGTTGTTCGAGTGGACAGGCTTCAATCCGATTAAAA
GTGGGTTTGGCCAAAATGTTGCCACTTTGATCGCGGATCCAAGGGTTCTCCGACCAATTGAACGTGGCCCAGAAACTTCGAATCTCCGCGGGCATGTCCC
CAGCACCCATCGATCTGTCGGGAAACTTCGCTGAGTAGGATATAAACGAACTCGTCTCCGTCCCACCAACTAACCGCCCCGTCAAGTAACCCCGCTGAGT
GTGTGGCGACCCATTTCGACAATTGATATAGCTGGTCTGGTGTCGGAGCTAGCCAGTTCCCAAGCGTCCGTTGTAACCCCAGCCCTGCAGGCGTGTAGCC
GCATGCTGCGTCAACATAGCTGGATTCACCCGCCATGTGTGAGCCCGCTTCAACCCACGGAAGGCCCAGCTACGCCAAGGTGCAAAGTACTTGTCCGAGC
GCTGGGTAAGCCATATGAAGGCGTGCTTGGTTCGTTGGGTTTTGACTGCGACAGTCACATCTACCAGCCCGATACCTCCCGCATGTCGAGGCGTCACTAA
GAGCCTCGGGTTGACCGTATGACGCCTGGCTTCTGTCGATGTATCGTGCGCCAACAAGAATTGCTTGAATAAATTGTGCAACTCCTTCTCAGCCCATATC
GGAATGTCAACGCTCGCTGTGAACAACAGGGAGGGAATGACAATGGTGTTCAGTATGAGAACTCTGTTCTCCACAGGTCGCTACCCGCGTTGACGTTAAG
AGGCGTCTTTGGATCTTCTGGATCCGAAGGGCTCAGTTCTTGTTCTCTAAATCCCCCGTTCCAATCTTGTAACCCAAATACCTGGTTGTGTCTCCCGGTG
CCACGACTTCTATCCCCTCGCTTGACCGTGATCGCCCTGTTGAGAAAAATGATCTGGCTTTATTTCGGTTGGACATGCAGGCCCGACAGTGCTCCAAACT
CGGTGACAATGCTTAAAGCATGCTAAATTTGCCCAACCTCCGCGAGGAAGACTGTGGAGTCGTCGACAAACGCTGAACATAGATGCGTTTGCCCTGGCAG
CCCCGGCACATCGAGCCCCCTTAACGATGTGTCCCGCTGTAATGCTTGACTCAGCACTTCCGCCACTAGCAGAAATAGAAGCGGTGAAAGCGGACAGCCC
TGTCGAATACCCGATCGCACCTGAAGAGCCTGAGACTGGCAGCCATTCACGTCAAAACATGCTGACGTACCGGTGTGGATGCGTCAGATGAGTTGTACAA
ACCGTTCATCAAAACCGAACAGGCGTAGCGCACCGTACATGAAATCTCTATCAACCGTATCATACGCCTTTTAAAGTCCAATAGCAAGATACATCTGCTC
TGGTCGGCGGTCACGTCTTCCCGCCCCGTTGCTGTTGTTAGTTGAGCCATCATCATCATCACTGATTTCGACAGTTTCGCTCGTGTACAAAACCTTGTTG
CGAGTCGCTGATAGCTCGAGGTAAAGAGTGTTGTAGCCGGGTTGCCTGCCAGCACCTTCGCAAAGACCTTGTAGCTTGTTTGCAGCAAAGAAATCGGTCT
ATAATCCATGGCATCGTCGGAATCGCCTTTTTTCCGAAGAGGAATAATCATAGACTCCAGGAATGAAGAGGGGACCTCCGACCCCGCTAATATGAAGTTG
CTGATGCTGACCAGAGCGGGGACCATGAGCGCAGCCGTGTCCTTGTAATAATCATTGTTCATCCCATCGGGGCCAGTCGATTTATGACGACCTAGCCCGG
TGATAGCCGCAAGCACCTTTGCGTCCGTATAGGGACGTAGCATCCGCTCATTATCGCCAGATCTGAGTCGTTGCTCCGGCGGTATGGTTACAAATGCTCT
CAACTTCACAGATAATAATGGCTGTACCACGGTTTGGTGACTCCTGTTGAGCACCTGCGCCCATTCCTACGCGAACTGATCCGCGA