Description :
From Genome Similarity Track
Location :
Scaffold_449:3863- 4936
Sequence
1073 bases(100 bases per row)
AGGGCTGTATGACGACCGGGAATGATTCCAAAATCCCAAAACTGGTTGATAGCGAATGTGTAGAGAATGTTGCCCATCACCATCGCAAACGTGAGCAGAT
TATTAATTTTTGCAACCTCTTTGGAGCGAGAGAGGGAGATTCTTAAAATGAAGGTCCAATATTCCCGTGGCACGTTTGCGTTTTTGCTTCAAAGTGCTTA
TGGAAAAGATTTGCACCCGCGAACCACATTATTCGACTCATCCCGATCTTGGGGACCTAGTTTTTTCCCGACCGGTTGCTGGCGAGGAACTCAGCCTTAA
CATTTGCCTCGTCGCAGGGGAGGGGTATCTGTGCACAGCTGTGTCATGCTATTAGCAGAGAGATCGCAAATAATTAGCAGTATAACGCAGAGTACCTGTG
CAATGTGAACCCCCGTGCGCTCTGCCACTGGTTGCAAAACCAGTGAAAAGTAGTTGTACTTGGTCTTGGCTTTGTCCCTAGCCATTTCACCTTCTAAGAA
TATCGCACATTGGAAGATGAGGGCGTCCGAACGTGGACATGGCAAATCTGCAAACTCGCAAAGAATTTGTTACAAATTAAGAGCATTTCAGAGAAGGCAC
ATATGTAGCCTTGGCGGTAACAGTAAGCCTTTAGTACTGATTGCGTTGTTGACAATCCATAGTTACAACCGGGTGCCAAGTCTCCATTCAGATATTGTAT
TTGGTGGCAACGGGTGGGTGACCGGCAGTGGGAGTGGTTGCAACACAACCTCCCTTTTTAATTTTTGACAAATTACTTGACTGTTAATAGATACTTCTTA
AATAAAAGCCTGTTAATAACGAGATCCCGTTTTAAGGATTTAAACGATGGTAAAAGGTATAATATTATTAACAGGGACTTTTTACCGAACATCTATACCA
TGCATCGATGTTGCAGACGTGACATGGATCGGCGTGTCCATTCATAATATCGGCTCAAGGTAAATACCATAAGAATATTATGCTAGCATATATTACTCTT
AGAACATTATTTTGTGAAATGATATTCATTGCATTTGGTAGTACTCTGCTTATTGGTGATACAGGCCATGATG