Description :
From Genome Similarity Track
Location :
Scaffold_1013:3862- 7269
Sequence
3407 bases(100 bases per row)
CCGGATCCAGGTCGCTTGGATCCACCTCACTGTAATGGTACACTCGCCGTGGATCCGAGCTCTCCAATCATCCAACATCATCTCGCAACCATCTGTGATC
TCCGTTGTCCCACGAAAGTTCGAGATCCACTGTATCCCTCATCCTTATACCCTGGATCCAGGTCCCTCCAGGCGGGATCCTCCCTCCTTGGATACGAACT
CGGAAGTATGGGACCCGGGGTACCTCGCGGTGGATCTTGACTCTTCATTAGCCGTGGCTACTAGATCCACCGTCAGAGGGCACCGACCATCCTTCCTTCA
TAGGATCCACACTCGATCCACTCTTGTATAGTATATCCCATATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCACCAGGCTCTGCAGGGCCTCCATCCCGAAGATGCCTGTCATCTTCCGAACCGACTCGAAATGAG
AGTCGTTCAAATGGGAGAAGTCGTTCCTATCTATGGCAACGAACTTCGGAGAGGTTCAGGTAGTCTACCCGCGGTGGCGTGGATTGACTACGAGTGCTAC
CAAGTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGTATACAAACTCTCAGTGAACGGCAGTTCACAGGTCCCCTCTTTAT
TTAAAGAGAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGGGTTTAATACAAACTATTAGATACCTATAG
AAATGCAATGTCATTTAACCAATGGTTGGCTTTGAACGACCTTGGTACCTTGTACCAAATATCCCGAAATATGACGTGTCATACTTCTGAAGTGCGACGT
GTCACACTTTGTAACGGGGTACAATCCAGTGTGCCCCATGTTACATAAAGAGTGACCCGTCACTCTTGTGGACACCTGGTACACGGTACCAGGTGCTCTC
GGAACCAGTCAGTGCATGACTGCTTAGCTTCACTATAGGTAACCTCTAGTTTGTATGAGACCCAAGCTTATCTTACTTATAAATACATCAGTCTTAAATC
TACTCCTCTAAGTAGCAAACCGTTCCCACTGAGACCGGGAGCACGTGGACTTACGTTCACTCGGGTAGTTAATACCCTTAAGCACATCCTCTGTGCAAGG
TGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCTTACACCTTCGCGGGTAGATTGAGCTACCTGAATCCTCTGTGCGCCCAACGTTTAAT
CCACGATGGACCGAAGTGAGTTTCCTCGCTTGAACGACTCACAGTACGAGTCTGCTCGGAAGATGGGAGACATCTTTGGACAAGATGTCCTTCGCAGCTT
GGCGGCGGCGACGCCTGCCGAGCAGCAAGAGCGCGTGACCGCGTTTGAGACCTACGAGCGTGGTCTCATCGCTCACGTCCGCGGGAGCTTGGAGGCCACG
ATGGCCGCTCCCCAGGCAACCAGGCCTAAGCCGGTGTGGCTGAAGGTCCCCGCGTTTGAGGGGAAGGGAGGAGAGAACCTTCACTTCTGGGTCCGTGAGG
TGGAGATCGCCATGAAGGCGGGTCTGATCTCGGACGAGCCAGTTCGGGTGGCGTTTGCCCTGTCCAACCTTGGTGGACGTGCCAAGCACTGGGCGTACAC
TAGGGAGACGACATTTCCTGGATGCTTTGCATCCTGGGCTCAGCTGTGTGAGCAGCTTCGAGCCGCGTTCCTACCGGCGAACAACGAGTTCCGCCAGCGC
TCACGCTTTCTCGCGTGTAAGCAAGGTAAACGTGAGCTGCAGGAGTACGCGCAAGAGATGCGCACGTTGGTGGCATCTCTGGCAGGGAATCCTCTGCCTG
AAGACGTCAAGACAACAGTCTTCATGGACGGCCTGAAAGTCGGTCCTGCTCGCACCCAGCTATTCCGAGTGCAAGCAACAACTATGGAGGAGGCGATTCG
AATCGCCCTCCAAGAAGAGTACAGCCACAAGCAGGCTGGTACTCCTCGGGAAGAGGAACATCGCCACGATGACAATGGCGTTCCTCGGGAGGTGGAGCAT
CGAAGCAATGACGCTGTTGCTCCTGCTGTCACGCAGCCCGTTAATGCCGGTGCGTACAGCGAGCCCGAACCCATGGACTTAAGCTCAGCCGAGAGCTTGG
TCCGCTGCTATGGATGCGGCGGACATGGACACTACCAGCGTATGTGTCCCTCGTCAGTCCTCGGGAAGAGAACAGCCCGTGGGCCCCAAGTCCGGTGGCG
CAGGCCACGGCCAGGTGGACGAAGACTCCCCAGCCACCAGTAGAGGCGGTATGCCCTACTGAAGAGCGCTAAGTCTTCGTGATGGGTGTGCAGGTTGTGC
ACACCACGGGATTTAGCCCAGAGAGACGTGGTTCTCTCAAACCGGTGAAGGGCAGTGCTGGGCTGCTGGTAGTACACTCAGTGTACGGGGGTACGATACC
CCTTGAACGTTTGATGGGTTCTGGGGCGTTGATACGCGCCGGAACGTCGCTTGGCATAGCGACATCCGACTGCACTCTATGTCAGAGTGGCGGTCGTGGG
CTGGTCCTTGGTGGACTAGCCTTTGGTACGGTAGTATCAATGGTCCCCAACGGACCTGAACGTTTCGGCTTGATGAGCTCGCGCACCGCGGTGTCGCTCG
CAGTTCTCGCCATGAACAACATGGCTGTGCCGAACATAAGGCACAGCCCGGACTTTGGTGTGGCAAGGCTGAGAAGGGCCTACCAGTCCAGGTCTATGAC
GGAGCATTGGTGAGTCATGTTCCCACCTCCGTCATGACTGGGGCGTCTGATACAGACCGCCAGGACGCAGAAGCGTCACGGAGCTGTCAACGCGCCGACA
GCTCTGCGTACAGCAAGACCATGCTCTGCTGCGGCAATGCCACGGGCGTGGGTCTTTTGCCCGGCGTGTGGAACTGCTACACCAGCATCGTCCAACGCCG
AAGGTCGTCGCGCCGTACGGGCTTCGACTGTGGTTATGCCTTTAAGCACTAACCAGGTGGGTAACTTAGGAACACACGGTCGCCCAGATCTTAACTGAGG
ACGCGTT