Description :
From Genome Similarity Track
Location :
Scaffold_1916:3860- 5047
Transcript NameFunction/comments
Phyta_totarag13861hypothetical protein

Sequence
1187 bases(100 bases per row)
CGACTGAAACACCCACTCCAACGTCGAGAAACGCGTGTAGACGTAGAGCGCTTTGCCCGCTAATAAGGTGTAGcacaccttcagcagctggaggagcgca
agcatctccttctcggctGGGTGGTAGTTGACTTCATTTTCTTTGAGGACGCGTCCGCAGAATCGGACCGGGTGTAACTTGCCTTCATGCATCTGCATGA
GTGTGCTGCTCAGAGCCCATTCATTAGCGTATATCATGATGTGTACTTCCATCGCCGAGTCGAAGTGGCGCAATATGGGAGCAGTGGCCACCTTATGTTT
TAACTCGGCGAATGCCACATGGGCTGCCGTAAGGTCACCGTCCGGACCAAAATCAGTCCCCTTCAGCTGGTAGAGGATCGCTCCATACACCGCCAACCCT
TGAATGAACTGGCTGTAGTAGTTGAGTGCGGCGAGGAACGCTTGCATCCCTTTCTTTGATTTTGGGAACGGCAACTCGGCTATGgcttccagcttcttgg
gGTTAGCCGATATCCCACTCGGTGAGACCTGGTGAGATAGGAAGTCGACCTTGGGTTGAACAAATATGCTcttcgtgaagctgacgCTGATCCGACACTC
AGTGAATCGAGTAAGGAATCGATATAGTGTTTCCAAGCATTCGTCAAACGTCCGTCCTCCGAAACAGATATCGTCGACGAATGACCGACGCTCAAACACT
GGTAGATTCATTGGGTTCCCCATTGCGAAACATGTCACCATCCGAGCTGTTAATCAGATCTTGAAGCAGATCGGACTCAGTGGTAGCCCTGTGGTCGACT
TCAAACTTGGTAAGCGAGctcagcgactcggcgtcTGACGTTTTAGCCGAGATAGCATATTGCTCACGCCGAGTTGTAGCTTCCGCTTCTGCTCGGCGCA
TGCGTTCTGCATACGATGCCCAGCCACCCCGAGGCTGTACGTACCCCCATAATGCATTATCGATGAGTCGTTGATAAATCATGGGTGCGTTCTTGAGTCC
AAATGGCATACGTAACCATTCCAAGTGCCCCAGTGCCCCAGTGCACACACAAATGCCGATATACGTCGTGCCCGTCGAGTCATTATTACTGCTCAAAACC
ACTGGCGGCATCGAGCGAGCAGAACCAGAGGTAACTTTCGAGCTCAGTCAGCAGGTCATCAACTAGAGGCATCGCGTATTCCATCAG