Description :
From Genome Similarity Track
Location :
Scaffold_154:386- 3394
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_154-fgenesh-gene-0.10Gene of unknown function
Pytul_var.sporangiiferummaker-pug3_contig_154-snap-gene-0.16Ubiquitin-conjugating enzyme E2
Pytul_var.sporangiiferumsnap_masked-pug3_contig_154-abinit-gene-0.34Glycosyl transferase, group 1

Sequence
3008 bases(100 bases per row)
TCGAGAGGCGGCGAATGGCGAAAGTCGGGTGCTGGTTGTGCCTGCTGCTCTGCATTCTGCGACGTAGGAGAGGGAGCTGAAGCCATATTGGTGGTAGCTG
AGGCGTAGCGTTGTTCGACTGCGTAGTAGAGAGAAAATTGGAAAATGAGAGTGGGGAGATGAAGGCTCGAGTTCTTTAAGACAGACAACTCAAAGGGATG
ACGAGCGGGCTTTCGAAAAAGCTCCCTCATCGTTTACCGTGGATAGAGGTCCAGTAATCTGAGAACCGTAGATGAGGCGTGGCTGTCGAGTCGACTTGAT
TTGGGCATGGCGAATTGTGTTGCAGTGGTCGTAATGCTGCAAAAGAATTTGCCTCTGTATTATGTAGAAAAAGTGCATGCAAGATGGTGAGACGTCCTTG
CAGCGTTGCTGCGCACGCCAGAGGAGGGCACGAGGACAGAGAATGCGCTCGGGCCGCACGCTATAATGCAGTGTAGCACTATCCAGCAGATCTCAGGGAC
ACATCGACAGGATCATCAAGTACGAAAACATCCCAGGGTATAATATACCCCAACATTGTTGCCAAGCTTTCACAGAGCAGAGTTTGAGTACCGGTATGAC
ATGTAGTACTACAACAGGTTTACTTGGAAGGCTACCAAACGCACCCCAAAAGGTGATCGCTATCAGGAGATTTGTGTCATGTGATCTGATTAAGTGCGTG
GGAATAATCTCGAGATTCCGAATCAAAACATCTCGCCACACACCAATCCGGATGCGGGTCGCTTGAGCAAAAGGTACTGTAGTCCATAATAGCGGATAGT
GGGAAAAGGCCCAAATGGCCACGAGTGGGAAGGCCGAGACCTCGATGCTTCCAAACGGCGCACACATAGGATTGGCAATGCTACTCAGTACAACACCATC
ACAGCACTGTTCTAGGCGGCTGGGCTTGATTCTGAGAGTGCCAAAAGCTGGGCAAATCATTAACAGCGTTTATTTACATGATCCAATGCTGTGATTTATG
TATCGAACGCGTAAGATACGTTTTCTTCGGTACAGTTGTTGACCGGTGCGATCCTAGAAAACGCATGTTGCAACTGTGTATGTGGGTAAGATCTATCTAC
CCTCCCATTGGTAGAAAACGCGTCTATTTTTATAGCTGTATTTATAGGTTGCAGCTCGTGTTGCTGCTTGAGGGGGGGACGAGAGAGACTAGTGCGAGCG
ATCATCAGTTTCGATATTGCGGCGTGAAGAACCCGAAGAAAAGCAGCACCTCCGAGCGCGATGGCGAGACGACTGACCAAAGTGCGCTCCTGCTCATCTG
CGCGTGTCCTGGCTTCGGTATAGGCGCCTGTGGCTCACTATCTCTATCGTATCGTATTGTGTGATGCAGGAGCTTGCGGAGTTCGAGAAGAACTCGCCCG
AGTGGTGTACTGTTGGCGCCGTCGACGACGACCTGATGCACTGGAACGCCATGCTCGCCGGCCCCGTACGTTTATTTATGTATTTATTTGCATGAGATGC
AGCTCAGTATGCGTGAGGTAGTGGGGTTGCTTATCGTGCTTACGATAGGAAAACTCGCCGTACTCTGGCGGTGTGTTCAGCATCGACCTGCAGTTCCCAA
ACGAGTACCCGTTCAAGGCGCCACGGGTAAGTACTGTAGTGGCATTTAGTATTGCGCATAACGACTGCAGCTGGATGGGAGTCTGATAAATACTGTTGTG
TTGTAGGTTCGTTTCCTCACGCGCGTGTACCACCCGAACGTGAAGTCGCAAAGCGGCGAAATCTGCGCAGATATTATCAACGAAGTACGTGTCCATGATG
GCTTTCACTGTAAAACGGCAATAACTCACTCAACTGTCTAATCTAATGTTGAAGAACTGGGGCCCAACGCTGAACGTGCTGCACTGCCTAACGGCCATCA
AGCAGATCTTGGAGCAGCCGGACGGGGACAACCCGCTGGAGCCCGAGATCGCGAAGCAGCTGCAGAGCAACCGCGAGGAGTTCGACAACACGGCTAAGGA
GTGGACCAAGCAGTACGCTTCGTGATTAATTACTCAAGTGAGGCCTTCGGACCAGCACCATAACCAAAATAGGCCACACACCCAGCTATATAAACGATGC
GATGAACATGGAAGAATGCACCAAAAATTTAAAAAAATGTGTCCTCAATTGTCACATGCTTATTAAAAGCCACCCACATAGTGTATATAGATAAATCACT
GTAAGGCTTCACATTAGAGCGCCCCCTAAAAAGCGCGGGTGTCAAGATCGCATTTCGACAATTGAGCTCTCCATCGAAGATGCAGATGCTGCACGCGCTG
CTCTACGTGGCTGTGGCACTCTGCGCTGCTGTTTTTGCTGATATCTGTAGAGGCGACGCGCCTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGTG
ATCTGGTACGCGCCGTTCCTGAGCGGCGGTGGGTACTGCAGCGAGGCGCATTCGTACGTGACGTCGATCGCCGCGGCGCTTCGCTCGATGGAAGAGACCG
CTGTTGATGAGCAAGATGGCTACACCATTAACACTCTACCGCATTCCCATGGAGGTTCCAGTAAAGGAAGCCAGGCTGCAGTATCGAGCACCAAGTATGT
GGCGCCGTTCTCGCTGCTGGTCACGCAACACGGCGACTCGCTGAACGCGGCGTTCATCCGCGACATCCCGGACTCTATGCATGAACTGCTCAAAGAGGTA
TCTTTGCTGCTTCCGCCTCTCTCGTGGCTGTTTCGTATGTATGAGATCTTCAGGATGGAGTGGATGGAGGACGCACTGACTCGTGTGTATGCGTTTGTAT
CTCATCTCCAGCACTGGATCGAAGAGCGCGACTTCAACTGGCGGCTGAGTGACCGCAAGATTGCGATCGCGATCTGCCACTCGGAGCCTGGCGCATGGCA
TCCAGCACGGTACACGACGTCTCGATGCCCGCCAAAAGGAGCACTCTACAAGGTGGGGAGAACGATGTTTGAGACCGATCGCGTTCCCAGCGGATGGCCG
GAGCGCAT