Description :
From Genome Similarity Track
Location :
Scaffold_730:386- 1739
Transcript NameFunction/comments
Physo_109720OSIGBa0146N20.7

Sequence
1353 bases(100 bases per row)
AAGAACGAGACGTGGACCCTGGTGCCACTGCCGAAGGGACGCAAGGCGATCGGCTGCAGATGGGTGTTCCGCGTGAAGGAGAACCAGTCTGGAGAGATCG
AGCGGTTCAAGGCGCGACTGGTGGCGAAGGGGTTCTCGCAGAAGTACGGCATCGACTACGACGAGACGTTCGCGCCGGTGGCCAAGTTCACGTCGATTCG
GGTGTTGCTGAGTCTGGCGGCCAAGTACAAGCTCACAGTGCACCAGATGGATGTGAAGACCGCGTTCCTCAACGGCTTGTTGGACGAGGACATCTACATG
GCGCAGCCGGACGGATATGTGGACGGAGATCGACCCGACTACGTGTGCCGGCTCAAGCGTTCGCTGTACGGCCTGAAGCAGTCGCCGCGGATGTGGAACA
AGACGATCGACGAGTTCATGTTGAAGCTGGGGTTCAAGAAGTGCGAGTCCGACCACTGCATCTACTTGAAGCGGGACAATCACGACATGATGTTCGTGGC
ACTGTACGTGGACGATCTGGTCCTCGCCAGCAGCAGCGACGGGATGCTGAAGGACACGAAGCAGGCTCTGAGTGACCGGTTCGAGATGACTGACATGGGC
CAGCTCAAGTACTTTCTCGGTATGGAGATCGAGCAAGATGTGGCGACTGGGAAGGTGTCGGTGCGGCAGACCAAGTTCGCGAAGGCCATTCTCGAGAAGT
TCAAGATGGATGAGAGCAACCCTGTGAAGACACCGCAGGATCCGGGTCTGAAGCTGGCCAAGGCCATGTGCGAGGGAGGCTGCAAGCACGACGAGACCAT
GGCGAATGTTCCGTACCGGAACGCCGTGGGCTGCCTCATGTATCTCATGGTGGGGACTCGCCCGGACCTCGCAGCGGCAGTGGGAGTGCTGAGCCAGTTC
GCAGCGGACCCATGTCCGATACACTGGCAGGCGCTCAAGAGGGTCTTCCGCTACATCCGAGGCACGAAGACACACGGCCTCGTGTTTCAAGCGAGCAGCG
AGGACGGACTGCAAGGCTACTCGGACGCGGACTGGGCCGGCGACATCGAGTCTCGACGGAGTACGAGCGGCTACGCGTTCATGATGAACGGCGGATGCAT
CAGCTGGCGAAGCAAGAAGCAGCGCACGGTGGCGCTCTCGTCGACGGAAGCCGAGTACATGGCGCTGTCGGAGGCCACGCAGGAGGCGGTGTGGCTCAAG
GTGTTTCTGTGCGAGCTGGGCGAGATGGCGAGCGATGAAGCGGTGAAGATCTACGAGGACAACCAAGGCTCCATCGCGTTGGCCAAGAACCCGGAGTTCC
ACAAGCGCACCAAGCACATCGACATTCGCTACCACTTCGTGCGCGAGAAGGTG