Description :
From Genome Similarity Track
Location :
Scaffold_20:385979- 387026
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007922Similar to UBC2: Ubiquitin-conjugating enzyme E2 2 (Medicago sativa)

Sequence
1047 bases(100 bases per row)
TTCTCAACCTCCTAAGAACTCAGTACATTTTCAGAAAACCAATACCGATCTTTGCATTGATATATCGGTTTTAGCTCCGGTATTATTTTTCTTTTGTTTT
GTCTGGTCTGTCTACCTATCTATGTTGCTGATGTTGTTGGTACAAGAATGTTGCCTACGGTACTGCTGCGCCGCCGACCCACCGACCCGCACCGCGTACC
TACTGGACGCATTCATACAACAACACTGGCGCACAGTCGGAAAGAAGGAAAGAAAGAAGCTCCAGCATAAGCAGTCAGCACCATGTCGACGGCCGCGAGA
AGACGATTAATGCGCGACTTCCGCAAGCTGCAGAATGACCCGCCGTCGGGCGTCTCGGGCGCACCCATGGACAACAATATCATGCTCTGGCAGGCCGTCA
TCTTCGGGTACGTGTCTGGCAAAGGAAAGAAGGGAAATCCATCCATTGGACCTCGTGGGTCGTCGAGGAGCTCTGTATGCAGTAAAATTGGCGAATACGA
CGGGGCTGTGACCGCTCTTGTGTTTGAATTGGTGTGGTGTTGATGCGAGAGAGAGAGAGAGAGAGAGAACGCTTTAACTGACTGACTTGTGTATGCATGC
ATGCTTGGTGTGATGTGTGTGTTTGTTTATGCGCTGTTAGCCCGGATGACACGCCGTGGGAAGGCGGTACTTTCAATCTGACGCTGGAATTCAGCGAAGA
TTACCCGAACAAAGCACCAACCGTGCGATTTATCACAAAGATGTTCCACCCAAACAGTACGTGCACGCGTCCGCGCTATAGGCTACAAATGCTGGTTATG
GTGCTGTTGTTCATACTGGATTGATATTAACGCTGTGAAACCTGTGGCTCTGTGTGCTCTTACAGTCTACAACGACGGCCAGATCTGTCTCGATATTTTG
CAGAACCAGTGGTCGCCGATCTACGATATCTCGGCGATCTTGACGTCGATCCAGTCGCTGCTCTGTGATCCGAACCCGAACTCACCTGCGAACTCGGAAG
CCGCGCGCTTGTTCCAAGAGAATCGCCGCGAATACAATCGTCGCGTG