Description :
From Genome Similarity Track
Location :
Scaffold_12:385863- 387279
Transcript NameFunction/comments
Phyin_T30-4PITG_07808Fidgetin-like protein

Sequence
1416 bases(100 bases per row)
AGCACAGCAAGAATTAACAAGTTAGCATGCGTCATTAAAACTCTAAAAGGGCCGGACAAAAGTACGAACCCCACGCAAAGCTTCTTTAAAGTCGTCCGAG
TTGATAGGACGAACGGAATTGGCATCCATCGTGCGAATATCGGCACAATTCCGGATCGGACCCATCGCAGCCTCAGTACAAAGTGCTCGCACATCTGCAC
CCGAATACCCTTCAAGTTGGTAAGAGCACACAATCAGGACGAACTCGAAGCGTCGTGATAATCCCACAGTATCACAAACCTTTCGTTGACTCGGCAATGA
AAGTCTTGTTCTCGTCGGTCAAGTTATTCCTGTTATCCTTGAGCAGCCGACTAACCAAGTCCAATCTGGCTTCAAACGACGGCAAAGGAATGTACAAACG
CTTGACAAATCGTCGACGTGCTGCCTCGTCAAGCTCTTGAGGTCGATTTGTCGCGCCTATAAACCCAAAGGACCAATCGGTACCCTAAAAGCCGATTAGC
AGTCGGGATAAAACGTACCAACAACTAGGATGATATCCTTGGCTTTCGTGCCAGCTCCGTCAAGTTGCACCAGAAACTCCGTCTTCATCCGCCGGCTCGC
CTCATTTTCTTCTGAGCTGCAACAAATTAAAGTGTAATGTATCCTGTCGATAACACGGATCGACGTCACTTACCTTCGTTGTGTCAATAATGAGTCAATT
TCATCAATAAATATCACAGAGGGCTGGCAAAGCACAGGGCAGTTGGAGGTTAGTATAGAATTGTGCCTAGAGGATCATAGATTCTACCTGCTTGACAGCT
GCGACGGCAAACAACGTTCGAACGAGCTTCTCTCCTTGGCCAATCTACATTTAATAAGGGCACAAGGGTTTTAAGTCCATTCGTACGAGTAAAACAAATA
CAGAGCTGCATCGCACCCATTTGCTCGTTAGGGAGCTAGCAGAAATACTGAAAAAGGTCGCCCCAGACTGGCTTGCAATTGCTTTGCCGATCAACGTTTT
ACCGGTACCAGGTGGCCCAAATAAAAGCAAACCTGCGCACAATGAAGACATATCGATGAGTATTTGCTGACAACCAGGACACTATATCGTAGCACGGCAC
CTTTCGGAAGAGAGCGGAGTCCCGTGAATATATCTGGCCGCGCCATGGGCCAAATCACCAGCTCGTTCACGCACTTCTTGGCAAATTGCAGTCCCGCTAG
AACACACAAAACGAACTATTAGTGGTCAGCTCTGCAAACCTAGGGCGACTGGATACCTCGTACCAATATCGTCGAATGTAATCGGGTCTCCGTTGTCCAC
AATTTCCATTTCAATCTTCTCGATTAGTTCCGGGTCACAGCTTTTAAGGCGCGGATCAATATTTTCGTCCTCGTCGGGCGGAGTAGTCTGCTTTTTACTG
CTGCACAAATAAAATG