Description :
From Genome Similarity Track
Location :
Scaffold_5:385811- 393886
Transcript NameFunction/comments
Physo_334544Avr1b-1 avirulence-like protein
Physo_507344predicted GPI-anchored protein
Physo_381224RNA binding protein, putative
Physo_511975Avr1b-1 avirulence-like protein

Sequence
8075 bases(100 bases per row)
ACGACATGTACATGGTGCGCTACGATGGGGCGAGCGAGAAGTGGGCTACGAAGCTCACTTCGTCCAGCGCCTCGCTGCCGCCGTACTCGTCGGGCAAGAC
TGGCCCGGACGTGTACATGATCTGGTGGTACGCTCACCACGCGCGTATCGCGTCGGACGGCACGAACTGGGCCGCGTACTTCGGCGCTGCCATCTCGACG
TCGGAGGGCGGCTGCATCAACATCCACCAGGGTGACCGCATGAAGGTGGTGGACCCGTCTGGCAAGATCGCCGACAACAAGGACTCGTTCGACTGGGGCT
GCTCGCACTCGGGCTACGAGCGCATCACGTACGACGAGCGCTCCAAGAGCTTCGCGTCGATCTGTAAGACGGACAGCAACAACCGCCTCATGCCGCCCAA
CAACTGGGACGCGACCATCTACCCCGTGGACCTCGCTGCCTCCAACCTCGGCGACATCGTGCCGGACTCGGTCGCCTCGAGCAACAAGTACTGGTCGGCG
GTGAGCAACGGCGACGGTGACAACGCCAAGGTGCACCTGATCCACTACGACCTGAAGTCGAAGGCCAGCGAGGACATTGTCCTGGGCGGCACCGACGCCA
ACGAGCGCGCTCCTCACCTCGCCCCCATGGGCAAGGACGGCATGCTGGCTATGTGGGAGGGCAGCTCGGCTGGCGGTGACCTCCGGGAGGGCGGTGACCG
CACGATCTACGCGCAGGTGCTTGACCGCGCCACGGGCAAGGCCGTCAGCGAGAAGATCACGGTGGACAAGTCGGTGGTGGGCAACCGCTACCAGGCTCTC
AAGAGCTACCCGGACGGCAGCGTGGCGTACCTGTCGAAGGGCAAGACCGACACGTCGGTGCAGGTCGTGCGCTTCTTCGGCTGCTAAGCAGGAAGGTTTG
GTCCTGTGTACGGGAAACAAACATAGATGAAAAGTGAAAGAGCTAAATTAATGGAAGTAGAAATGTACTGAGAGAGATAAGGCCCCAAGGTGCTTGACCT
AGTGGCGTATATTTAGGCACTCATTTCGGAGCCTGCTGGAAGCTGGCACTTTGACGTCTAAGTGAGTTACCCTAAACTATTCCTAGTTGATCGGTTTCCC
TTCCTGAGGTCGAGGTCGTGGTGAGGCGGCGGATTGAGGGGATGCGGTTGCTGATGTTAATCGGGAGTTCCATTAGGGGGGTGACTTAAGGGGTTCCAGG
GGATGTAGTGATGGAGGTAGTCGGGGGTCGGAAAATAGACTTACGTGGCGTTTGTATCGGAATCGCTCCGGGCGAGACTCGAACCCTCAGTGGAACGCTT
GATCTTCGTGGGCCTTACCCACAGGGACACTAGGAGCCCCCCGAAGTAGAAATGTACTACTACTAGGAAATGTGTTTGATAATTGCGTAGTGTTTCTACT
ACGTAGTACGTTTGTTCTAGGTAATTTAGAATCCTAACCGTCGCTTGAATGACAGAGATGTGAATAACTGGCTCTGTGGGATACGGTTGGTGGCTGCAAG
CTAGCTTCCTGTTGCGTGTGGGCCGCTGGATCGGGTAGTCTGCTAGGTTTAGTGGGGTTTCTCTTCCTAAAATGAACTCTCGTTACTGAGTCGGTCAGTA
TATTATTGCCACGAAATCCTTTAATAAATTTTGCACTGTGCTGTTCATGTTGCCTAACTGTAGCGGTTCGTGCTCGCGCCTAAACGGATGCGGTAGCAAA
ACTTTTAGCTATCTGTCTGCCCCTGCAGGAAACCAGATGTTCTTTTTACGCTTCTGCAATTCGTTGCGGCCCGCTTTCTGCGTACGAATACCCACTTATT
TGTAGCCTAGACATACCAACATCGCGCACAGGCTGTGCTGTGCGGCACAGCATAAAGGCTCTACACTCGATTTCTTTCGCATCACAGATCTACACTACAA
TAAAAAAGTGTAGTGTATAGGGTATACAGTATACATGAGATACGTCATCATGACGTTATCAAATACTCAAAGTGCGAGTGGGATCAACGCAACAATGGTC
AATGAACCTGAGTACTGTACCTAAAATTCCCGCAAACCACTTCTTCACAGGCGGATTTGAGTGACCTCCACAAATTATCCTTTTCTGCAGCGCACGTCGC
CCCACCCGAAAAATCGTCTTCGATGCGCTCTTGCTGGCAAAAGGCGAAGTCTTTACAAACCAACTATCAAACACATTTCCTAGTAGTAGTACATTTCTAC
TTCCATTAATTTAGCTCTTTCACTTTTCATCTATGCTTGTTTCCCGTACACAGGACCAAACCTTCCTGCTTAGCAGCCGAAGAAGCGCACGACCTGCACC
GACGTGTCGGTCTTGCCCTTCGACAGGTACGCCACGCTGCCGTCCGGGTAGCTCTTGAGAGCCTGGTAGCGGTTGCCCACCACCGACTTGTCCACCGTGA
TCTTCTCGCTGACGGCCTTGCCCGTGGCGCGGTCAAGCACCTGCGCGTAGATCGTGCGGTCACCGCCCTCCCGGAGGTCACCGCCAGCCGAGCTGCCCTC
CCACATAGCCAGCATGCCGTCCTTGCCCATGGGGGCGAGGTGAGGAGCGCGCTCGTTGGCGTCGGTGCCGCCGAGCACGATGTCCTCGCTGGCCTGCGAC
TTGAGATCGTAGTGGATCAGGTGCACCTTGGCGTTGTCACCGTCGCCGTTGCTCACCGCCGACCAGTACTTGTTGCTCGAGGCGACCGAGTCCGGCACGA
TGTCGCCGAGGTTGGAGGCAGCGAGGTCCACGGGGTAGATGGTCGCGTCCCAGTTGTTGGGCGGCATCAGGCGGTTGTTGCTGTCCGTCTTACAGATCGA
CGCGAAGCTCTTGGAGCGCTCGTCGTACGTGATGCGCTCGTAGCCCGAGTGCGAGCAGCCCCAGTCGAACGAGTCCTTGCTGTCCGTGATGGAGCCCGAG
GGGCTCACCACCTTCATGCGGTCGCCCTGGTGGATGTTGATGCAGCCGCCCTCCGACGTCGAGATGGCAGCGCCGAAGTACGCGGCCCAGTTCGTGCCGT
CCGACGCGATACGCGCGTGGTGAGCGTACCACCAGATCATGTACACGTCCGGGCCAGTCTTGCCCGACGAGTACGGCGGCAGCGAGGCGCTGGACGAAGT
GAGCTTCGTAGCCCACTTCTCGCTCGCCCCATCGTAGCGCACCATGTACATGTCGTAGCACGGCGAAGCGGGGCTCGGGCCGCCGCCACACAGGTTGCTC
GGGTTACCGCAGTTGAGGGTGCCTCCACCCTCGGCGTCACGCGTGCCCACGATGACGAAGCCGTTCTTGTCGGCGTAGATGTCACCGAAGTCGTGCAGCG
GCACCTTGACGGCGGGGCTGCTGGCCACGAGCTTGTCGTTGGCGTCGAGTTCGCGCACGATGACGTTCTCGCCACTCTGGAAGGCAATGCGAGAGCCGCC
CGACGGCAGCGAGGCGATGGCGATGACCTTGAGGGCGGCCTCCTCCTCGTTGTTCTCCACAGAGGCGCCCACGTCGACCTCCGTGATGCGCACGCGCGGC
TTAGCGCAGAAACCGCCGCTGGACTTGGGCGTCGTGGCGGTGGAGTTGCCCGCAGCGTCAATGCCCGTGGTGCACACCGCGAAGACGGCGACGGTGGTGG
CCATGAGAGCGTGGTACAGGCGCATGGTTGGTGGATGCTTGGGTTGCTCTGGGAGGGGCTTCGGCGGCGCGGGGCAAATTGGGAAGTGAGAGAGTGGCAC
ACCGAAGACTTTTAATCAGACACTTTAATCTTGTCCAACTTGGAACTGCAAGGGTCTGCTGTTCGTGTCTACGATGAGATCGCAGCAGGAAAGATAACCA
GACTCCAGATGGAGTGTCGTACCTTCGCCGGAGCCCTGGTAATGCACCAAGCTTCATCAATTGGATGTCGGCTTTTGTGGCTGCGCTAGACTGGCGTGTC
TAGCAGAAACAGAAGGACACTGAAGGCTCACGTATCTTAGCAGAAACAGACGGAAGTTGAAGGCTCACGTAGCTCTTCGATTACATTTTTTGTGCAGTGC
AGTCACTCGTCTGGTAGACGTACACGTACACGTACCCACGTGCAGGAGTTGCTGTAGTACAAGCTAGACCCTGGCTACGGGGAGGGTGTTCTCCGTTATT
CGGCTGCAGGTTCGGATAGACTACTGTAACACCAACATGGGACGATTTTCATGGTATTTTGGTGGCTCAAACCGATGAACCTACCGCGATCCTGGTGCCA
CCAGCAGGTTGGCCATTTGCGTAGAACGGCTGCCAGAAGCGGAGTCAGCACAATTGACGACCAGCTGGGAATGCCGAAACCTTGGTCTCCACAAACAGCG
AAAACGTTTGCTCCCAGACCTTGATGGGGGTTTGCGTCATGATTTGGGCCGGTCACTGGTACATGTATTATAGTCAGAGTTTGAAGCTTATTGTACCCGT
ACAGCGCTGAGCAGCAGCAACTGGCCATCTCCAGTTTGGTGTGCTTGCTACGGCGAGCTTCTACTCGTTGACTCAATAGTCTATGATTTCGTATGCCTAG
CCAACACGCTGCTTGGTATTATTTTAGACCAGAGTGTACAGTAGTGTAGATGCACAATGGTCAAGCTTGACAGGAGCGGTGTCGCACATTGTGACTCATA
GTGCGTTGGTAAACTCATTTCGCGAAAGTGCACAGTCCGTCGGCTGTGACCGCGAGGGCCAGATGCGACGTTAGCAACCAATTCGCGAACCAACAAGCTG
TACAGACTTCTTGGTGATGCTGCAAAAGAATACTGGCTGCCGAGAAACCTCGGCTCTTGTATTGGTGCTCTCAACGTCGCTACATGTACGATCATATAAA
AATCTGGCGGTACCAGTGGTGCCAGTGGTGCCAAGCAGGTTAGCATCAAATATGTATCAGACAGAGTGCACGATGCCACGAACAACTGCAATGCGACCAC
AGCAACACAGTGGCTGCTGCGTCATCAGAGTACAGTACTGGGCATTGGGCCATTCCATACTGCTGTTCGTGTTCACATGAAACTGTTATATGTCGTTGAC
GCATCCGTCGCCACCACCACCTCATTGTGGCGTAACATTCACGCGGTGCAGCGTCATAAAGTCAGGGATCTCGGCGTACATACTCTGCCAAGGTAATACC
TATCTGGTAGAAGTACTACGAAATGCTTCGAGCTACATGTAGATTTTTGGTGTCGTATCTGATATGAAATTGCGTGATCAATAAAAAGTGATCTTGTTAA
TAGGGTGCTGTACGCAACCTCAGTTCGATCTTGTATCGAATGCCATACGTCCGTTAGAGCGGCCTGTACAATAGGTGCTGCAGTTCCACTCATTCAAAGT
TCTCGTAATTCCCCGGTACACCACCAAGTGCAGCGGTTGATGTTTTAGTTTTAGGGACCACTACATCGCAAATTGCTTCAGGTATTCTGCCGGCTGTGAC
GGTGGAGCCCAGCCGAAACCCAAGAGACACTTAAAGCCTGTTCGCTACGTAGCTGGAGATGGAGACGAAAACCAAAAGTGTGACCGGATTGGTCAAAAGT
AGGTACAACTAGAGATGGCACTGTGAATTCGTCTCCAGCTCTTTGAGGTGGAGAGGGGCGGATCTACCTAGAGATTTACAGGGCCAGGCACAACATGGGA
GACGAAGATGCAATTGTCCTCGCTGCGTGCTCCGCCGTGGCACAGGCTGTGGCTTTGTATGCAGACAGTTGCGAACCAGGACCTCCTGCTGGCAAGAAGA
ACCGTTTTATCGTCACCACTCTGCGCTTCGAGTCGATGCTTCAATCATCAGCCTATTCAAGCTGGTTCGAGACCAATCTGCGCTGTACGAGATCCACCTT
CTTCCGTATAGCTAGCTTTCTACAAGAGCATGGGGTCGCTTTTGCACAAGCTAAGGTCAAGAAGCATTCCTACGAAAAGAAGGTGGCAGCGGCGCTGTAT
TTCCTGGGCTCAGCGGGTGGATATCGCGAGGTGGGAGCTGCAATGGGCATGGCTAGAAGCTACGTCATGGAGATCACTATGGAGGTAGACGTTAGAAGCT
CCTTTCAGACGAGACTTGCCTCGGCCCTGTGCTGCTTGCGGTGCGGCCGAGGCTTGCAGACGCTCGAGCATGCGAGATGGAGCGGGAGTAGGCTCTGGCG
TAGCAGACATCGCCACTGATACTTGAGCTAGCGGAACAAATGTGGACGCAGTCTCGGCGCCTTCTAGCAGCAGACCTTCATCACCGGCAGATGGTGTCAG
CGAGACGAGGGGCTCGGACGCTGGCGTTTCGTCATGACGTGCGGGGGGCGCAGGAACCGAAGAGCCTTGAGCAGCGGCATGTGCCGCACGCGTGGCCGCA
CTGGTGAGGCGAGTCGGCATTTTCTCAAGTGGGGAGGAGAGCCATCCCATATCTGTCCTGTGATTGGCTTAAAATTTGTCTGGAGATGGATACATAGCGA
ACGAGCTGTAGGTGGAGATCAAGCACCATCTCCATCTCTAGTACAACGCCAACAGGCTCTTACGACAATTCGATATGCGCTCCGATCTTTGAAGTTGGCG
ACATAGACCGATTGGTAGTTTGTCGACGTTAGTTTTACTGCATTGCATGTACTGTAACGAATCCTTGCAGCAAATTCACGCCCATACCATCGACAATTAA
TTAGGCGCCAATCGGGTTGCTTGTATTCGTATTGTAAGACCGTTGCTGGCCTTACCGTCTTGCTGGTCTCCTTATCATATTACAGTATGGCGGCGCCATG
CACACAGGGCGCCACGCTCCACTTTGTTTGTCATAAATCGTGATCCAGATGCTGGTGAGGAACGAGCACGGCATGGTACAGCGCCAGGCTGGACGCTTGA
CGGCCCAACAGAAGCTCGTCCAGATGGAGTTGATGCACTTCCCGCTTGGCACAAGTTCACCAGCGTGGGGCTCCGGATGAGCCCTTCGTTGTGCTGTTCG
AACGAGACGGAGGAACTGATTGACTTCCGACGACCTCATTTTCCAATTGGCCTTCTCCAGCCACAACCTCATCGGCTCAAGTAAGACCAGAAAAACACAA
GTCCATCATGCGTCTGTATCACGCTCTGCTCGTCACCGCCGCCGCCGTTCTGGCCAGCAACGTCTCCGCCGGCCGCGCCGACTGCGACATGGTGCCGGAG
GTCCCTGCCGGCTCGTACGGCACGTCCAGCGGCTCGGCGCCGGTGAGCCAGGACTCGACGGCCAACTCGGACGTTGGTGCCAGCCAGGCCAGCCACGGCT
CCGCTCCGGCTGACACCCCCGTGCAGCAGTACTCGACGGCCAACTCGAACAGCCAGGGCTCTGCTCCTTCGGACGAGACCCCTGTGCAGCAGGACTCGAC
GGCCAACTCGGACGTTGGTGCCAGCCAGGCCAGCCACGGCTCCGCTCCGGCTGACACCCCCGTGCAGCAGTACTCGACGGCCAACTCGAACAGCCAGGGC
TCTGCTCCTTCGGACGAGACCCCTGTGCAGCAGGACTCGACGGCCAACTCGGACGTTGGCTCTAGCCAGGCTAACCAGGGCTCTGCTCCTTCGGATGAGA
CCCCGGTGCAGCAGTACTCGACGGCCAACTCGAACAGCCAGGGCTCTGCTCCGTCGGACGAGACCCCCGTGCAGCAGGACTCGACGGCCAACTCGGACGT
TGGTGCCAGCCAGGCCAGCCACGGCTCCGCTCCGGCTGACACCCCCGTGCAGCAGTACTCGACGGCCAACTCGAACAGCCAGGGCTCTGCTCCTTCGGAC
GAGACCCCTGTGCAGCAGGACTCGAACGTTGCCTCTGGCTCGGGCGCTCCTTCCGGCGACGACGACACCAAGCAGGACGTTGTTGTCCCTGGCACGCCCT
CGGGCTCGGGCTCTGAGGGTGCCACCCCTGCCCCCACCACCGGCCTGGACGTCGGTGCCAGCCAGGAGACGACCTCTTCGGACTCGGGTGTTCCCCCCAC
TAAGCAGGGTGTGGAATTCGTCACCCCCGCCCCCACCACCCCGTCGACCGAGGATGCCTCGCAGAAGACCGACGTCGCCGGTGAATCTGACGTTGCCGGT
GAGGCTGACCAGGTGACGGACGCGCCCACCACCACGCAGGCCCCCACGGTCGCCTCGAGCTCGAGCTCTGGCCTG