Description :
From Genome Similarity Track
Location :
Scaffold_117:3858- 5333
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_117-fgenesh-gene-0.1ATP-binding Cassette (ABC) Superfamily

Sequence
1475 bases(100 bases per row)
ATTGTGCTCGAGAAGGAGAAGCAGCTCAAGGAGTACATGCTGATTATGGGCCTCCAGCCCATGGCGCTGCTCATCAGCTGGTACTTGCTCTACTTTCTGG
CGTCACTCGCGCTCGGTGTGATCGCCGTCGCGTTGCTGAGCGGCACGATGTTTGTCGCCACGCAGGCGAGCGCGTGGTACTTCTTCCTGCTGCTGACCAT
CTTCGCGAGCAGCATCCTGCTCTTTGGCGTGAGCATCACGCCAATCTTCAACCAAGCCAAGACGGCGGCTGCGTGTGCGTCGCTGGTGTACTTTGTTCTC
GGTGCGGGGCCGTTCATCCGGGCGCTGGTCGGTGAAGATGCCATGGAGAGCTCGGTGGTGCTCGACTTCGTCGTGTCCAGACTCGAAGAGGTGAGCTCAC
CCGTGGTGTTCATGGCAACGCTGCACGACATCATGGGGTTGGACGCGATCACCGGCGCGGTTCGTCCTATCACATGGTCAACTGTGAGCGGTCCGTGTCA
GAAAATGATGCTCCAGAGCGCAGGCTACTTGTTGCTCGGGTGGTACCTTGAAAACGTGTTCCCACGAACGTACGGCGTGCAGCAGCGATGGTATTTCGTG
TTCCAGCTGTCGTACTGGTTCCCAAGCTACTTTGCGAAAGCCCCTGGGTTTAGTGAAGAGAATGCCGAGCTGCTTGGCTTGGAAGAGCTCGGCCAACAGG
ACTTTGACAATTCCAAGGACGAGACATTGCGCGAGATGCCGTTGAGAGAGTACGTGCACCAGTTCAAGCCCATTCTGTTTGTGAGTTCGCTCTCGAAGCG
GTATCCGAACGGGAAAGAAGCGCTGAAGAACGTGTCATTCGGCGTCAAGAAGGGCGAGATCTTTGGTCTCCTCGGTCCAAATGGCGCTGGAAAGAGCACG
ACCATGTCGATTCTCTGCGGGATGCTGTCACCAACGAGCGGTGATGCGATTGTCGGCGGCTCGGCGAGCGTCGCGAAGAACCCAGAGACGATTCGGAAGA
GCCTCAGTGTGTGCTTCCAGCAAAACATCCTCTTTGACGAGCTCTCAATCGAAGAGCATTTGTATCTCGTGTGTGCACTGAAGAATGCGATCGGCATCAA
GACAGTCGCGCACGAAACGTGGGAAACGAAGCTGCGTCAGTTTGGGCTCTCGGAGAAGCGAGACGCGCTCTCGAAGACGCTCTCGGGCGGTCAGAAGCGC
AAGCTCTCGCTTGTATTGGCGCTCTTGGACAACTCTCGCGTGGTGCTGCTTGACGAACCGACTGCCGGTATGGACCTGAAGGCGCGACTGGACACGTGGG
ACGCACTGAAGCGAGCGGTGAATCATCGCGCAGTCATATTGACGACCCACTCGATGCAAGAGGCGCAAGCGCTCTGCGAGAACATTGGCATTGTCGCGGA
GGGCAAATTGAAATGCTGTGGCTCCAGTCTCTTTCTCCGTGAACAGTTTGGTGTGGGCTACAAGCTGACGTTGGT