Description :
From Genome Similarity Track
Location :
contig_9:385783- 388540
Transcript NameFunction/comments
g2790.t1POM71755.1 Hypothetical protein PHPALM_11634 [Phytophthora palmivora var. palmivora

Sequence
2757 bases(100 bases per row)
GCTTGCTCATGCGTTTGCCTTCAACGCTGCAATTGCGCCTAGAATCTCTGTTGTCAGCTGGTGGTTGGCCATCCACATCGATTCACTGTCTCGCTTGTGG
CGCTTTGACACTGCGTCCGAGTTGGGCGCCTTCAGTGGCAGAGCTGGAAAACGCTCAAGCGCCTCGTTCTTGACGTAGTCCCAAACCGCACCTTCGCCGT
TGACCTGCTGGAGTGCAAACAAGACCACGACGGGGCCTCGGTACCACCACCCAGGGTGCCGCGGCTTCTGCGTGTCCAGCATGACAAAGAACTCAGCACC
GAGCTCCTCGTAAGCAGATATGATAACCGACTCGAACGCGTTCTTCGCCGTGAGCTGACGGTTGCTGCGCTTGTTGCAAGCGAGCAGGCTCGTCTTGCGT
GACATGGGAGCCCAGAAGTTGCGCTCCCACACAGCACGAGCGTGGTTGCGCCAAAACTTACGAAATCTTCGTGAAAGTTCAGGGTGCTTGGGCTCATCAA
ATGGTGCTGGCAAGTTGGAATACACCGCTTCCCAGGGGATCTGCGCCTCAAAAGGCCCCATTTTCCGAGTTAACTCCAGCTGACTGCGGCAAATGTCACC
ACTCATTGCCGGCTTACCTCTTCTGTGAGACTTCTCTTTAGCTCGCGCGGCTCTATCAGCCTTACGCTTTCGTCCTCTATTGGCCTTGGGGGCCTCCAGC
GATTCAGCCAGAGAAGCTTCAACCGGTTCTGCAGTTGTAGCAACACCAGAACCCTTTGATTCATCACTTGCAGCTCTTTCTTGCAGCTTCCTGCCACGTT
TTGGAGTTGACACAGCGGCGACTTCAGTTTCACTGTCGGGCGCATTCACAGGGATCCGCTTGCGTCGCCTCTTGGTGACAATCTCAGGCTCTTCCACAGG
AGCATCGTCAGGACCCTCCACAGCTGCAGCATCTTCCTCCAACACCGAAGCCGAGTCATCTTCAGGCTCTCTAAGAGCTACCACATCTTGCCGTTGCGCT
GAATCATCAGCAACAACCGCTGTAGTCTCTCTCGTCGCCGAAACACGACGAAGTCTCTTCTTTTGAGGCATCTGCACCTCGTCAGCTCGTGCTACAGCAC
GAGTGACCGCTCTTGGCGACGCTGCCGTCCTCCCTCTCCTCTTCTCCCCCTTCTGCTCGACAGCCACGTCCGTCGCCACTTGCTGCTCTGGAGGCGGTGC
CTGATACACAGGAGATACCAGTTGGGGCAGCTCGAACGGAATCACACTGATCACTTGACATCCTCGCTGCACGAAGTCCATGAGCGCCGTATCTCGCTGG
TACACGAACTGCAGGAACATGTGCTTGAGCAACGCCATGTTCCTCGTGGCCGTGCGGTACTGCAGGTAGAGGAAGACGCAGCCGCGGGAGTCGAGGGTCC
ATTTCGGCTTGGACAGCAGGAATTTCGCTTGCTGCCGTCTCTGGGCGCTGGTTCGAAGCACCGGGAAGACGGTGATGATGGTACAGCCTTGCTGCATCAT
TGGCACCAAGGTGTTCTCCTGCTCATTGAGGAAATCGGCGAAAATGCGACGCAGCATCCACAAGTTCTGCGACTTGAGACGCAGCTCCAGGTAGACCGCA
AAGTCCTGCAGCATTGCGTGGTCTCGAGGCACCGACGGGGGAGGAGCTCGGCCACGACTCACATACCCGTCAAACGTCACTACAGAGCGCGCACGCGTTG
TGTGTCCCGAGGAATCGACGGTCGTCGCCATCGTGTCGATCTCGTGGATAGTGATGAATGACGAACAGGAGTCTGAGCCAACGGCGTTTGACTAACCGAA
ATGCTATGTGGGACTAGGACTGACGCAGCAGTTGACCCGATTCTTGCTGTCCGAACCAGCCGAGCCACGTCTGGAAGGTTTTTGCTGTCAGTTTGGTCTG
ATGGAACTCTTTGGCCGTAGCGTATTTGCCTTCAGAGGCGAGGATTTCGACTGCTCTGGAGCGAGCCCATGATGCAGCAGAGTTGGCAATGCGTTGCTGG
GCTCGACGACAGCGCAGTCGCAGCTTGGCACGATGGGTGGCGACTCGTCGCCACTGACGAAAAGCTCGAGTTTTAAGGCAGCGAGTGGCCAAGTGGACAG
TAGCAGTGAGCTGACTCGGACCTCCACTGTACAGACAGCGATAGAGGTAAAAGCGGGTGTACGCCTGCAAGACGCTCGCCTTCATAGCTTGATGGGCCAG
CAGAGCCGCTCGACCGAGTACCTTCGGACTAATCGGTGGGTTCTTTGGACTCCGAAGCAGCTTCACCGAAGTCTGGCGAGCCACACGGAGCTTGATGATT
GGCTTTCTTGCTCGCAGTCGAACGCGACAACACCCCCTCTCCTTGGACTGTTGCTGGTGTATTAACCCCGTGCACTTGTCCGTCCAGCAGCTCCGACGTC
AGCTTTTCGAGCGCAATCGACTCGCGCTGATACTCTCGTCTCGTCGACGTACTCAGTAGCAAAACGTCGCTATTAATCACTCGCAATTGCCCATCGAAGT
CTGAGCAAAAGGAGGCGATCAACGCAGTGTATCTACGAGCACAGGCGTCCGATCCAACACGCGCGACTGATTCCAGTTGATCCTGAGCTCCCCCGAGGTC
GTTCGAGCTCGAAATTTCACGCCGTCGATTCGCGTTTGAGCCAGCAATTGTTCCTCTTCCACTCCGCTTTGCAACACTTTTCCTTTGCAAGAAAATCTTC
TTGGCGCGGGCTAGCGCCGGGAACGCCGCGATGTCCGCCATGATCACTGCTTCAACA