Description :
From Genome Similarity Track
Location :
Scaffold_16:385782- 388685
Transcript NameFunction/comments
g18156.t1hypothetical protein

Sequence
2903 bases(100 bases per row)
TTTGCATGGCGTACGTCCATCAGCAGCAACACCAGGTCCCTTTTCGCCAGCCGCCCGCCGTCAAGCACTTCAACGTGACGTCACCTGGAGAGTGTTTTTG
TTGCACCGTGAAGGGGCGCCAGGGGGCCCCCAATGAGTGGCCAGCATTGCGCGCAGGGGGACGCGTTGAACCCAGCGCTGCCGTCCGTCCATCTCGTCCC
ATGTGGACCACTGCGGTGGTCGATACCGCCGCCTAATGCCAGCGTGGCTGGAGCCCTTCCGCTGCCTGCCACCGTTGCTGCTGTCATCTCCTTCGTTTAC
GAGCAATAGACCCGCTCGGTCAGTGAAGGGGCGCGGGCTTTGCCGGCACCGGAGACGGTGGACCGCAGACAGAGACTGTGGCCATCAGTGCGCTCGCGGG
CAAGGGCGGACGAGCCCGGCGGTCACAATCGCATTGTGCGATCACCAATTGCGCGCGAAGAGGCACGTGGGAAAAGATACTTTTTTGCGTTACAGTGTCC
GCGTTCCACGGAAAATGCGCCGAACAAAACGGCATGCCGCGCTTGAAGTGCCTAAACCTGCAAGGTTCGAATCGAGTGGCACTCAGCGTCTCGAACGCCT
GCATTGCAGCCGATGCGGGTCCTGCTGTCGGAGCCAAGCCATCCTAGCCGCTGTTCGCCTAGTGCTGTCACCATCGTTCCCGTGGGCGCTCTACTGCTCG
GGCTGGATGTGGGCGATGTCCCAAGGACCGAGAATCTCGCTGCAAGGGGCACAAAAAGAACCAGGCATCGAAAAAGAGTGAGACCGCCATTCGTGCGTCA
GGAGCGGCGCATCTCCCTCGGTGCGCAGCTGAAAAAACTGCAGAAAGACATGCTCCGCCAGGCAACACACACAGACGTACTTCTTGGACTCCTGCACGTG
CATGAACCAGAGCGGGCACACGAGCGCCAGGAAGAGCACGAAGGCACCCGCGAGCACGCTCAGCAGCGCCGAGAGCTGCCACGTGAGCGCCGACGAGAGC
GCGAAGAGCGTGGCCGCCGTCATGAGGTGGGCCCGCTCCGAGTGGCGCTGCATGTAGGTAGACGAACGCAAACGCGTTAGCATAAGACCGCCGCAAGCAC
CCCCTTCCGAGCAAGCAAAAAGATGGATGCGCACCTTGACCTCGCGCTGGAAAATGGGGAACATAGCGAAGATCTCGATCGCCAACAGCACGAACGCAAA
CACGTGCTCGTTCGACCTCAGTCGCGAGCCCAGCAGCACCGCCGTGAAGATAGCGGCGTTCAGCGAGATCGTGCCGCTGAACCTGCAGTGCAACACGTAA
CACGTCAATCGTGCCAGGCGCTAGTGGGACGAGTCGCTACAGCGATCGAGCGACCGATTGGCTCAGTCCTTACCGGCCAATGCCCGAGTTGACGTAGTTG
TAGTCGTGCGCGATGAGGTGCAGCAGCCCCAAAAGCGTCGCCAGCGCCCAAATCGTGTCATCCGCATACGACTTCGTGAGCGTCCGCAGCACGGGCGACA
AGAGCGATAGCGTAGCGCAGAAGAGCAGACTCGAGCTCAGCATGTCCAGCGTCTCTACAGTCAGCGGAGCACGGTCACTAGCAACCACAGCACAACATCG
TCTTCGTCACTTACGCAGAGGCAGGCCGAGGTGGAAGCGCAGCACTGCGAAGCCAGCCACCGCCAGGAACACGTCAATGCCGCCCAGCAGCACGGCGGAC
ACGGCATCTTGACGAACGAACTCGAACACTGACTGACAGCAACCAACAATAGGAAGCCCCCGCGTTCAGTGCCATTCTCTATCGCACACCTATCGCCAGC
TACCGCAACACACAAAGAAGATCAAGATGGCGCAGATCTGCTGCGTGATGGCCGCAGCCGAGCGAACCATGCCCCCGTAGTTGAGCTCCCGCACATTTGC
TGCAGAGCGAGCAGGCCAGGCTTAAATGTTAGTCGTAGCTGTAATTGCAAGCCCTTCGTTTGTAGCGAACTCACCGTTCGTGCGCATCTGCTCCAGGAAC
GTCTCATCCACGTAGTTGTCCTCATATGGCTGCGGGGCGTACAGAATCTTCTTCCACTTGGGCTGCTCCATGCACATAACGCGGTTTGTGAGCTCGTGCA
CCACAGAACAAGCTGCGCTGGAGGAAGGCCCACCTTGATCGCCGCCACCATGTCGGAGAACTCTGTATCTGCATCCCATTGGCTGAAAATGGACGTGGTG
CACCGAGCCACCTCTCTATGGGACGACCGCATTCCACGCGAGTGTCGTTGCCCAGTGTGGATGCCAGCGCTGTGTATTGTTGAAACTGGCTGGTGTCGCT
AGCTCATTAGGATTTCCAACGGTACTTTTACGCTGTTGACAATGCTGCATGTTGGGGGGTATATAGCGAGCCGCTACTAATTCAACAGGGCAGCACCAAC
CCAGCAGCCGCCGCCATGGGTCTATCTATACACAGCGAGAGCTTAGCTGCCAACGGGGCAAATTGAAACGATCGGGCGGGGACCGGCCCCCTGTCAGTCA
CCCTAAAGTAGCGGGTTCCTAAGCGACGGCCATTCCACCTCCGTCATAAATTGGAAACCCATGGATCGCTGGACCCAATGGGCGGCCCTACTTGTCAGGT
AGGGCATTAGTTTCCTTACTCATTGAGTTTAAGCCGGATTGCAATAGGGCAAGCCTCACAACGCTATAGCCTGAGCTGTTCCTCACGTACAATAACCGTA
GTTAGCATGCCGGCTGGGTAAGGAAGGCGCTTGAAGGCAAGTTGAAGTGGGTGAGTCACCATTGAACAGATCTCAGGATTGAAAGGCGGCAGCAACAGAT
TGATTGGAAAGCAGCAACAGATTGAAAGGCAAGGCTCAGTAGCTCATCTTCTGTGGGGCCGAGCACCATGGGCAGATGCCAAACTGCTTGACCCACTTGT
TCC