Description :
From Genome Similarity Track
Location :
Scaffold_36:385772- 388793
Transcript NameFunction/comments
Phyin_T30-4PITG_14616Putative uncharacterized protein
Phyin_T30-4PITG_14617Putative uncharacterized protein

Sequence
3021 bases(100 bases per row)
AGCTGTCGGAATCAGAAATTAACACTTCTGAGTCTGAATCTAGTCGATTGTCTGAATGTCGCGTTGCACATCAGAAAAACCAGCAAGCGGACACAAGTTC
AGCAACAAAAAGACAGAAGACTACAAGGCCGGCAAATTGGCAAATAATGCACAACCAGCATCCTCCACCCGGCCAGCCTCAGCAAGGTTATCCTCAAGGA
GCGCCGCCACAGCAGCCAGGTTACCCACCCCAAGGACATCAGCAGCCTCCTGTCGCTCAGCCCGCGTATCCTCCTCATGCAGCTCCGGCGCCTTATCCTC
CGCCACCACAACAGCATCCTTATCCACCTGCCCCCGCTTCGGGCTATGCGTACCCGGCGCCGACTCCGCACGCTTACCCTCATCCTGCTCCGGGCTACGC
AGCACCTCCTCCTCCGGTCTACGCTGCCGCGCCTCCCCCCGTGTATGTAGCTCCTCCGCCTCAACCAGTGTACGTTGTCCAGCCAGGCGTGCACCATGCG
CACCACCATCATCACCACGGCTACGGTCACCACCACTACAAGTATAAGCGCAGAGGACTAGGTGGCTTGCTGGGCTTCGGTCATCGACACCACGGCTACG
GGCACGGCTATGGTTACGGCCATGGACACTACGGTCACTACGGCCACGGCTACGGCCACTACAAGCACAAGGGCTACAAACGCAAGGGATTCTTTAAATG
AGCTGTCGTTGTCGGGTAGACGATAGCTTTAGTATGTGAAATACAGGAGAGTCGTGCGTTCAATTAAAATAACTGCCTGCATGCAGTCCGTTAGACACTT
CCTGGGATGTATCCACTTCCAACTGACTTTGATCAAAACAGACGTGTGTACACTTTGTCTAAGTAGGTCGAGGAGTGCAACGCCTATCCTGTCACCGATT
CCCTCGAGCATTAGCTCTTGCGCCTCAGGTTCTTGCTGTTGCCGCGCGCCCAATTTCCGTCACGTGCTGTCACCCGGCCATTATCACTACTACGTCGTCG
ACATTCAAAAGCCGCAATATCTGCTGGAGCAATGCCCAATGCGCTGCACATGTACCCATCCGTGGTGTTGCTGCTGTGGGTCTGGGTCACAGGTGTGATA
CTCCAAATCATTGTCATGGTAGGCTGGTGGACCTATCGCTACGAACGAGAGACCAGATCAAGCCGTGGGCGGCACTACCGTCCTGCAGACCAAGACGATA
CTACCGACTGTGCGTCGATTGCAAGGGATCGCAGGACGTCGGTGGACGTGCCGGAACTAAACACGCGGCGGTATTCTGTGGAGCGTATAAAGAAAAGAGA
GGAGACCGCAAGACTCCATGCTAAGCCAGCACGTACTGGCGCAGAAGACGACGGCGAGGGAAGCGACGTCCACGTCTTCAAGTGGAAGCAGCTTGCACGT
CGGTCGGCTCTCGTCACGCTTCTCGTGGCTTCGGCTAATGTTATCACGACTACGATTGTGCTCAAGCTGCGTACTGGGTCTAATGAGGAGCAACCATACG
AATGGTACTCGCTAGAGAACACTGGGAAAAGACTGTTCCAGGATACGCACAAGCTGCCGGTAGATATTATGAACACGTGCAAATATCGCGATGCCATGGC
AGATTACACGGAATTTCGGACATTGGATTCAATCGTTGAGCGTTATAAGAGACAACGCGGCGAAGTGAACGCCCTGCAGACGGTAGTGTACTTGGTGCCT
TTCGACTACAACCACGTGCTGGAGCTGAGTCCGGATCAAATGGTCCCCATTGTAGAGCCGCTACCAAAGTTCTGGACAGCGTCGAGTCCGTCTGGTGATG
GCAACAGAGATGCAGCTGCGATCGTAGTCTCGGGTTTTGATAAGGCACGTCCTGTGGACGAGATCACGCTGTTCCCGTACTTGTGGCACAGTCTTCTCGG
CCCTTACTTCGACTCTCGTGTGGAGACACCAATCGATGAACCTTGGACTCGTAGAATTGATGCTCTGAATCTGGAATTCCGCATGATTCACAACGCACAG
GAGCTACGAAGTCTACCAGCTAGGAGCAATCTCTTCGTATTAGCGCAGTCACTCGATTGTGTCCATCGTTTCTTCGAGAACGACGCGCTCCCTTCTGACC
CTCGTGTCGGGTTCCTCACGATGTCGAAAGAAAGCTGCAACAATCCCAATCCCGAGCGCTTCTTGGACAACGCAGCTATTAAGTTCGGGCTCATCCCGTA
CGGCGACTGTGCTCTAGTAGATGGGAAACGATTCGCGTCACTACCGCTAGGACCCAGCTTTGAGCATGGCTTCCCATTGAACGCGCACCGCCTCAACCCA
CCGCGTCCTCTTGCGACTGGTATCGGTCGTAGATTCCTGTTGAATCTCATGGTCAGCTGGACTATTGAGAAGCCGACCCGAGTGCAAGCTATGATGGCTG
CGCTGCAAGTATGCGGGGATTTAGAGAGCGTCACACGAGCCAACACCCGACGCTGTGTTGTAGAACACAACGACATGTTGTTCAAGGTTCTACAAGCTGT
GGACAAGCGCATGGGTACAGCTTGGCGCTGGTATTTGTCGGCTGCACCAGCTGCTTATGTCTCTACATTGCAGCAGTCAGTGTTTACCATTTGTCCGCTA
GGGAAGAACCCAGAGCAGTACCGAATCTGGGAGGCGTTATCGTCCGGCTCAATCCCTATTGTTGAGGAGTTACCGGCACAATGCCAGCCCCCTGGAGTGT
TTTATCACCCGACATATCCTGATTCGTGGCGCTGTGTGCCTGAAGATGTTCATGGCGTGCTTCGTCGCTTGCATGCACCTGTATTGTTCGTGAGCGACTG
GAGACGAGATCTCCCAAGACTGATGAACCAGTATTTCAAGAAGGCGAACGAGAATGGCGATAATTTATTAACGAACTCCAGTGAAAGCAGTGGAGAGTGG
GGAGAATGGACTCCGACCGAGGAGCTGCTGGCCCTGCAAGCACGTACTCGCTCGTGGTACGTTGGTCTCAATCACCATTTACAGTCAGATTTTATCGACA
AGGTCGTCACTCATTTTGCAG