Description :
From Genome Similarity Track
Location :
Scaffold_227:38566- 39763
Transcript NameFunction/comments
Phypl_g5621conserved hypothetical protein

Sequence
1197 bases(100 bases per row)
CTCTGTGCAAGCCCTCAGCTCAATCCTGTTGGATCAAGCTAAGGACTTGCACAGAAACCCTCGATGTCAAAGAGGAACGGCGCCGCGCCGGCGTTGATCA
CGGCTTCGTCGCCAAATGCGTGAAGCgacactgcagcagcgtagTCACCGGGCAGCACCGTCACGGGCGCCACTCCGACCAACTCGCCGTTGAGGGTGAA
GAAGATCTGGtgctcgtcggcgtccagacCGCAGCCAACCGTGAACGTGggggcgtcctcctcctggttTTCGGACTGAGTCGTAGCTCGGCCCCACGAC
GGGCCGAAGGCGCCCCACTCGCCACCGTACGGCTTTGCGCCATCGTTGAACACGAAGTCGCCGTCATTGCCGTGGTAGGCGTAGGACACGCCCTTCCAGC
CCACGTGCTCTCCCGAGCCGAAGCCGTAAGCGTTCCGGGTCGCCGCGTCGGAGACGGACGCGAGACCCACGCTTCCGCAGCCTTTGAGGCCCACCTCGTA
GTATGATACGTTCTTGAGCAgggcgcgcgcgcaggaGAGCACgggcagcttcttggcgccgcgGATTGAGTCCACGGCGCCcttgtccaagctgcgcagc
aTCGAGTTGTTCGCCACGCGGTACTTGCCGTCGGGCAAGTGGGTCACCGCGCTGCGCGTCGACAGCTCAtagtcggtgtctgggcggcgcgcggcgcaCA
GCGTGAGCTGGTCGCTGTAGGGCAGCGTCACATACGCCTCCGGCAGCATGTTGGCGCGCCACTGGCGGCTGTACAGGCCCGCGAGCAGCATCTCCGAGga
cgcgacgacgtcgtggaaGGCCGTACAGACCTGTGtggcgtcctgcagctcctccatcgtgaGGAACTCGAAGCAGAGCTCGAGGGCGGCGAGTTCCAgc
gcctcgccgtcgcgcgtGTGGCGACGTTTgaggcgcagcgccgtcagcagGTCCGCGACCTCGGCCGCGttctgcgagcgctgcaggTCGCTCCAGCGGA
CGTTGGCGTGCGACTGGCTGTGGCGCttggccacggcggcgtaCGACTCGTAGAGGACGCAGCagtcctcgagctcgaggtcggagacgtccagctcgtc
gtcgctgctgttgctggccgtggagcacgagctgctggcgatgctgccgcggcgacgcgcgaggcggcggctcgacgacttcttggtcagcaccacg