Description :
From Genome Similarity Track
Location :
contig_49:385649- 388568
Transcript NameFunction/comments
g8320.t1hypothetical protein
g8321.t1hypothetical protein

Sequence
2919 bases(100 bases per row)
GAAGTCCAGGCCCTTGGCCAGCTTCTTTTTGTCCACGATGGCCTTCTTCAGGTCCAGCACGCGGATCACGGCGCCCGGAAACGTCACCGTGTCGAACTCC
TTGGCCGACTTGAACTTAAAGTGGATCGACATGGCCTGGAGTTGTAGGGGGGTCTAAAACGTGGCTACCGGCGCTGGATGGGTCTACACACGCAGAGCTA
CGCGATGATCCCACTCCCGAGGCACAGATCGACGTGCGAGACGAGCTACGGCGACGAGGAGAAGCCGAATGATCCGAGCGGGCCTGCCGCTTGTGTCGAG
CGAAGAGCTGGTTGGTCAATGCGGACGGGGGGCCAAAAGCAAACGCGCAAACGTGGCATCCGATAACCTTTCATGTAACATATACTACTGACAACCATTA
AAACCAAACTGATACTAATATTGGACTTTATACTTACATACACTGTGTAAGCATATTCGCGGTTCTATTCTCGAGATCTTTGTCGGTGTGGCCTACCCCA
ATTACACGTGCGCCACATGTTCCCCCTTTTTCTGCGTACCACGGTACTTTTGAAACTTGAATTTTGAATATCTGAACCGCCTCCATTCGCCTCCATCCCG
GGTGGCCATGACCATGCAGGCGCGCGACCCGACGGAGCTGCTAGCGCCGGCCGGCGGCAAGGAGAACGCGGCAGGCCGCGGCAATCAGGCGGCGACTTTG
GCCATGCGCGCTAAGCGCCGCGGCAGCAGCAGCAGCAGCGATGCGGCCCGCCGCGTGTACGACAGCGACCGGTTCAATCTCGTGCAGAGTCGGCGGGGCA
GCGGAGCCGCGGCCAGCCCCGGCCACGCGCCGGCCAGCAACCAGGACGAGCACACGGACGTGGCCCCACCCGTGGCCCCAGCAGAAAAAGAAGGAGCCCA
CGCCGCAGCCTGTGGTGCCCGACCAGATCCTCGAGGCGTATCTGGACGCCGGCGGCTATGTCAAGACACGCACGTACGTCAAGGGCAAGTTCCTGGGCAA
GGTACGCTGCAATGCAGAGCTACCCTGTTCGTGGTGCTAATTGGTGCTGGTTTCTTGTTGCAGGGAGGTTTCGCACGCTGTTACGAGCTCAAATGTGAGC
AGACTGGCAAGATTTACGCCGGCAAAGTGGTGGCCAAGGCGTCACTGGTGAAGCCCAAGGCCAAGCAGAAAGTGAGAGCTCATGCGGAGGTGGTGTGAGA
TTGATGCTGATGATGTGTTGTACTTTTGGTGGTGGTGTCCTTTCTCGGTGATGTTGTACTTTAGTTCACGTCGGAGATCAAGATCCACAAGTCGCTGCAT
CACCCGCAGGTTGTGCAGTTTGAGCACTTTTTTGAAGACGCGGACAACGCGTACATTCTGCTGGAGCTGTGTCGGAACCAGTCCATGTCGGACTTGATGC
GGCGGCGGAAGAGGCTCTCGGAGAGCGAAGTGCGCTTCTACATGCGCCAGCTCGTGGACGGCCTGGCGTATCTGCACGAAAACCTCGTGATCCATCGCGA
CTTGAAGCTGGGCAATCTCTTCCTCACGTCGGACATGCGGCTCAAGATTGGAGACTTTGGACTCGCTACGCGGCTGGATAATCCAGAAGACCGCAAACGC
ACAATGTGCGGCACGCCCAACTACATCGCGCCGGAGATTCTGAGTGGTCAGCGGGGCGATGGACACAGTTTTGAGGTGGATATCTGGTCGACGGGCGTTG
TCATGTACACTTTGATCGTCGGGCGGCCACCGTTCGAGACGGACGACGTCAAGGCCACATACAAACGCATCCGTGCCAACCAGTACGACTTTCCAGAGAC
GGTGCAGGTATCAAAGTCAGCACAATCGCTCATTCGAGGCATCCTACGCAGTGATCCGGGTGCCCGACCATCGCTGGAGCAGATTTTGAAGCACCCGTTC
CTGGCCGACGAGTTAATTCCGACCTCACTACCCAGAACAGCGCTGCTAGTTACGCCACCATCATGCAAAACCCAATCTTTCGCTAATCGTCACAGTGATA
GTGAGCGCTTTGCAAATTCAACTGGTGTAAGAGTACCGCCACCTCCAGCAGCATCCAAAAGATATCCTCTTCAGAGTCGAGACGTGAACAATCACACTCA
ACGCGCCTCCGATCCTGGGGCATCACCCATGGCCCAGTCGCTGCCTCCTGCTTATAAACGTGACGGCTCTGGTCGGACCTCAGGATTGTCTAGCTCCGCT
CGACGAAATCTAGCTGCAAGTAGCAGTACCGCGGCGGAGAGGTCTTCACACACAGGATCAGCGGAGATCTTGGCTCCTTCTCAAAACGTATTGGAAGGGG
CTTACAAGTCTCTGTCCCGGTTTTTCTTTCTTCAAGAGCACACTCACAGTGGAGATGAAGGCGACAAGAGGCTGAGCGAGTCATCGTCTGCCGCTACGAT
TGTTGCTGCAGCACGAAAACTGAAGGAAATTCGCGCAGAGGCCGAAGAAATCCAGCCACTCGTTCCTGCAAGCCTGTGGATCTCTCAGTGGGTCGACTAC
ACTTCCAAGTACGGCATCGGCTACATGCTCTCGAACGGTGGATCAGGTGTGTATTTCAACGACTCCACCAAGATGATCTCCTCTGCAGATGGCCGAGCGT
TCGAGTACATTGAGCGCCAAAGCAGTCAGAATCCAGGACCGGAGCATCGAGTCTGCTACACCCTGGAAAATTACAACCCGGCACTAAAGAAGAAGGTGAC
GCTACTTGGCCACTTCAAAGGCTACTTAGTAGACGCCCGCGCGGAGAATGACGAAGCCGACGCCCTTGAAAACCAGCTCGCGCGGTCATTCGTGCTCTCG
TCTCGAGAAGTTGGCACGAATATTAGTGTGGTTGGCGGCAGTGCTAACGACGGCTCTGCCCAGTCAATGGTGTTTGTCAAGAAATGGGTCAAGACTCGGC
ATGCCGTGCTCTTCCAGCT