Description :
From Genome Similarity Track
Location :
Scaffold_79:38563- 41314
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_79-fgenesh-gene-0.10WD repeat and HMG-box DNA-binding protein 1

Sequence
2751 bases(100 bases per row)
CAGCCATGGAGTCCATGAAGGAGATCACGGTCAACATCAACGGCATGGGCGGCATGGTGCTCTTCCAATCCAAGCGCGCGCTCAAGGACGACGCGCAAGT
CGGGCACGACATCGTCGTCACGAGCGGAGAAGACGGCGTCGTGTATTTGACCGACTTGAACACAGAGACGGTCGTGTCTGAGAGCGTGGTCTGCGACGGA
GCCGTGCCGTCCTGCGCTGTGACGCCCGAACAGACGCACTTGCTCGTCGTACAGGAAGAAGAGAACTCGCTGTACAGCTACTCGATGCCCACGAGCGGCG
CTCCACAGATGGACAAGCTGCTGTTTCGGTCCACTGTCGTGATTCGTCAGGTCGTGTGCTCGGAGAAATATATCGCGATCGCAGACGAGGAGTCGAAGGT
CAAAGTACTGCTGCGATCCGCGACCGACCAAGTGATCTTGATTGACGGGCACGACCACGGCATCAAGAGCGTCGCGATTGACCCACAGGAAGAGTTCATC
TGCTCGTCCAGCGAAGATAGCACGGTGCGCGTGTTCAAGCTCGATCCAGAAAAGATGAAGGCTGTCGAGAAGGCGGTGTTCAAAGTGCAGTACAAGGACA
TCAAGGACGACGAGGTGCTCTGCCGGTGCGCGTGGCAGCGAGGCGAGAAGAACAACCTGCTCGCTGTGCCCGTGAACCAGGGAGTCATTGAGCTCTTCGA
CCGCTCAAGCTGGAAGAGCGCGGGCCAGCTCATGCTCCCAATCGGCAAGAGTATCAGCTCGGACATCAATATCGTGGCGTTCTCGCCGAATGGCATGTAC
GTCGCTGCGGCGACGCTCGCAAAGCAGGTGTTTGTCTGGTCGGTGGTAACGAAAGAAGTGGTGCGCTCGTTCAAATTGGACTACTCAGTCCTCTCGGTAG
AGTGGGCGATCTCCCAGAACGCGCTCGTCGTGTATCACGCCGGCGGCAAGTTTGGCTTTGTGAAGGACGTGATCCCAATGGGTCGAACACCACCGCAAGT
GAAGCAAGTGTTTGGCACCGGCGCTCCAGCTGCTTCAGGAACTACTTTGGCATCAATTGATCGAGAGAAGTCCAAGACCACGCAAGCCTCGAAGAAGACC
AAGAAGAAGAATATGAACGCGTCGTCCTTCATCAACGATGAAGCAGGCGAAGACAACCACAGCATTGACGACGATGACAACGAAGACGAAGATGGTGACG
AGGAGGAAGACGACAATGAGACCCGCGTTGAAGCGATCAAGGCGAGCTTTGGCTTTGGCCAAGCCTCAGCAGCGAACACCTCTACCCAACTCGATGATAA
CGACATGGACGTTGGCAACCGTGACGACGACTACGCAAACGGCAGTAGCTCTCGCAGAAACTTGTCATCAACAGGTCTTGGAGCTTTTGGCTCCACAATC
TCACCCTTCCGAACATTCACCGAGCCATTCCAGTCTGGAAGTGTCAAGGACGGCGCGGTGTGCCTCTTGGCGTGGACACCCGTGGGCGAGATCGAGACGA
TCCGCGGCGCGAACCTGAGCGAGAACCTCGTCAAGGTTGAGTTCGCAGACAAGGCGCGCCGCGGCTTCAAGTTCAGCGACAACTACATGTTCTCCATGGC
GTGTCTCGACGACCACGGCGCGTTCTTCGGCGTGCCGCGACGCGCGCGCGAAGATTGGGAAGACGATGCCGCGGGCGGTGGCAACAGCAACAGCGACATC
ATCAGCAGCTTCGTGTTCTACCGTCCGTTCGAGTCCTGGGCGAACAACAGCTCGTGGCACCTCGACCTGCCCGAGGGCGAAGACGCCGAGTGCGTCGCCG
CTGCGGCTGAGTTCTGCGCCGTGGCCACGTCGCTGCACTGCCTGCGCATCTACACGACGAGTGGTGTCGAGTACGCGCTCGTGCGCTTACCCGGCCGCAT
TGTGACCATGACCGCCAAGCAATCGCGACTTGCGATCGTGTACCAGGACGTGTTTGGGAAGCTCGAGTACCAGCTGCTGCAGGTGCGAGTGGACTCGTCG
TCGCACCGCGTGAAGTTGCTCACCAAGGGTGACTTGCCGCTCTCGCCGCCACCCGCGGATGTGTTTGCCTCCCACAAGGAGAACGAGCAGGCGCGCGAGG
ACCTCAAGCTCTGGTCCACGCTCTCGTGGCTCGGCTTTGACGACCGCCTCATCCTGTACGCCGTGGATTCGCTCGGTTGCGTGCAGGCGCTCACGGAGAG
CGTCGGCTGGAACTGGTTCCCCATCGGCTGTATCGGCAATGCGCTCAACAAGAAGCCCGACGACCGCACGGGCATCTTCACGCTCGGCATTGTGAACGAT
TCGCTGCTCTACTTCCCATTAGAGAAAGGCGTGCGCGCGCCAAAGCTGCGCGGTAAGCACCGTCCCGTGCCCTTGACGTTCGTGTTGCGCAACGCGTCGT
TCCCAAAGACCTCCGGCGGCTCGTCATCTAAGAAGGCGGACGCTGCCGGCGCGAATGTGATGTGGCAAAACGTGCGCGTGTTTGGACTCGAGTCGTTCTC
GGCGTTGGAGAATGGGAACAGTGATGAGATCGAGAACACGCTCGTGCAGGAGCAGGCCGAGATGGACAAGGCACTGATCCTGATGATGAAGACCGCGTGC
TCGAACGACGAACCCGCGCGTGTGTTGGACCTGGCCAAGTGTCTGCACCTGGAGAAGTCGCACCAGATCGCGCAGAAGCTCGCGATCCACTTTGGGTTGC
GTCAACTGCAGAACGAGCTCTACCAGCTCTACTACGTCAAGTTCGAGCAAC