Description :
From Genome Similarity Track
Location :
scaffold_116:38561- 43271
Transcript NameFunction/comments
Pl_109414hypothetical protein PHYSODRAFT_467853
Pl_109415hypothetical protein PHYSODRAFT_467556

Sequence
4710 bases(100 bases per row)
TGGATCGAGATACGCCGTGCTGTCCTGTTGATTTTTTTCGAGGCTTCTGCTATCGCGTCGTCAATGAGGCGCATCCACTCAGCTTTTGAACTTGCACTAT
CAGCGAACACGACAAAGGACTTGACCGGGTTCTGGATTTGAAATGCATTTTTTAACATGACACCGTCCGGGATATTTGAAATCCGCGTGAGTTTTAGACG
AAGCGAGTTGTGCGGACTCCACCTCCCAGTCATACTTTTATCTGCGTACACCAGTTGATCATTGAAGAGGAAGAAGCGATAAAGTTGGTTGCGTGACCGG
CACTTCTTCGTTAGATCACCTTCGTGGATGAAAGTGGTAGAATTTTTCAGGTAGAAGTGACCACGTTGAATACGCTGAATAACCGAGTCCAGTTTCTCTG
ATTTCTGTCGGACTTGAATTGTCTCCTTCATGTCATTCACAAGGAGATGAATATCTCCCATAGCTTTCCACGGATCATCACTAGCAGCAGCGTCTTCGAT
AGTCCGAGCCCACTCATATTTTATGTCGTCTGGAATATTCTTGCGGGTATTATCGACTGGGTCTTCCTCCATGTCCTCATGGGTAGAGCCATCCAACGAA
TCTTGCACTTTTCTCAGCAAGCCGCAAAATGCCTGCCGCTCGACCGGCATGTTCAAGAACAAGCACGTGGAGATGCAAAACCGTAACAAGTCAAGGCATT
GCATTCTTGTGGACAAATCAGACTGGTTATCGCACAAAATGGTTGTCGACAAAGTGAGCAGGGAAAACCACACGCGCTCAAACAAGATTTTGATCAAATC
TGGGCTGATGGGAGTATCAACACCAACAAACTGGAAGGTATTGTAGGCATGAGAGAGGTCTTTCATGAGTTCTTCAGACTGAGCTACAGCCTTTGCGATA
CCACCACGGAATTTCTCGTTTTCCAGATCTGCAGTCGTGATACTAGCTTCACGGGTGGCTTTCGGAATAACACGACTACCTTTAATATGCATCGGGTTGT
GCGCGATATCGTCGTAAATCTCCTCGAGAAACCGCTTTGGAAGGTCTTTCCCGTTGTCAATGCCTCGGTTGTTCTTAACAAACTGCTCCTTAGACATTTT
GTTCTTTTTCACTTGGGGGTTGTGCAAGTCTGTATTCAGCATGATGATTGAATAGGCAATGATCATTGCAGTGTCCGCAGATGAGAATGCTGTCCGTGAG
TCGTCCCAGTAACACTGCGCAAATGCTTCAACCATGCGTTCAATCTTCTGTGCCTCTCCTGGAAGACGAAAGCCTCCGTTTGTCAGAAAATGCCGCAAGG
ACTCGACGAGTGACATCCCCTTGAATGAGATAGCTCGAACGTATGTCAGTCGAATTTGGACTTTAAAATCTTCGTCACCTTCGCCTAGATAATCTCCAAT
TTCAGTCTCATCAAAGAAGTCATGGTATATCCGTAGGAATGATGTTACACTTCGTGGCGTGTCCTTGATGAAATTCATTGCTACCAAATACTCAAGAGCC
TTCTTTAAGCTTTTCGACGATGAAATCTCCATCGCACGCTTCAAGAGCTGCTGATTGTGTTTCTGGAGTTCATTTCGCATCCGGACCGAGATATTGCCGC
CGTACTTGCGATTTGTTTGCCGTTTAAATTCGGGATGCATCGGTGAACTTGGCTGACTTGCTCGGTCAGTGCTGACATCGCCATTTGCTATTGCCATGAA
TGCGTCTTTCATTGGCGATGCTTCTTCGCCCGACTCATCCTGTTCCCATCCGCCGTTGTCCATCGATAGCATACGAGTGCGCTGATCTCGACTAATGAGG
TGAGCATGACCACTGGCGTCCATCACGCTGCGAGCCATAGCAAGAATCGTATTGATTGCTTGGTTTTGTAGTTCTAGGGCAGAGTCGTCCCCCTCATCCG
CATTTGCAATGTGGCCCATTGTACCCTCTCCGATGGAGCCGAGAGTCGAGCACAAGTGCTCAAATATTTTCCACTGCTGAATTCGATCCAAATCAAAGTT
GAGAAATATTTCCACGACGTTGTGCGGGAGTTGCAACCAATTCGTCATTTCATGCATGATTTCCAATTGATGGTTCCTCGCGATAGGTGCAGTAGTCCGT
AGAATTCGAAGAAGCACATGCTCAAACATCAGCGCCAGCTCTACTTTAAGATACCGTCTATAATGATTCCAGAGTGTTGATAGCAATCTGAGATTAGCTC
GAAACACGCTTGGCACCAAAGTGAGAACAGTGGAGTTCAGTGTCGACAGCACAAACCTTCGAACCACCTGACCAAACACACGCTGATCACGACCTCGTGG
TCCAACTGCAAGAAGTGTCTGGTTGAGGGCACGAAGAGTGCTTACACTGGAGCACTGGTCGATTTCAGTAGCCGTCTCGCTTAGACCAACAAACTTCCGG
TTAACAGCTTTGCTAAACGTAACAACTAGCTGAAGAGCATTCTTTTCGGCCTGGCGGATCCACATATGTAGTTAGCGTCTGAAAAACTTTCACTTGAGAT
GTGCTGACAACAAAACATACCACAGAGTTGGCGAAGTTATTCATCGCTGCGGACATATCGTTGCAAAATGTCAGACGCTGAATAGATAAGTGACTCTGCG
TTGCAAATAATGAAGAGATACATGTTAGCTACAGTGATGGCAAATGTGAACAAACAAGGACTTTACCTTGAAGACGCCTAGCATGTTGTCGGTAATGGTC
GCAATCTCAGCGCCTGAAGCGATATCATCGATGAGATCCATAACTAATTCGTGAGCAAACTCATTTGATGATTGATCGATCTCGGGCTTGTTTCTCTCGA
TGGTAACTGATTTTGTGTTGATCAATGAGGCTTCGTATGCACACATGATCTTAGAGATCAACTCATCCTCAAACGTTTTGGTAAGGGAGCCGTCAAAGTC
TCCAATGCATGTTACAGCCGTTAAAATTGCGTGAAGTACAGAAGGTTGGAACCCTTTTGTACACTTTCGAATGACCTTGGTAAATGTAGCAACAATAAAA
GTTGTTTAGCTATACCAATCCATCTTATGTTGGAAACTCATGTACTATACCTTTTGAAAGAAGTGAAGAGCGGACTCAAAACGCGATTTAATCCCCTGTT
GACAGATCGATGTGACTGCATCGATCACCACCTCAAGCCGGCACAACTCAGATCCGGGGCAGTCGAATACGCCTTCATCGAGGCAATGGGTGAGTCCTAC
TAATGCCGCTTTTGCTGCATTTCCATGGCGAGTGTAGCACGCCAACAACAGAGGATACATGTAATACTCGATTGTCTCCTTCCAACCGATATTTTTTGCT
TTAGGGAATACACATATGTATGGTTAGTTATTTGGACATGTGCTAACATAAGTTAATGAACTTACATGCCGGCAAAGGAGGATCATCTGAGGTAACCGAA
CGTGGTGAGCTAGGAGCAATCAACTCTTGTTCGCGCACCTCAGTCGCTTTTAAAGCAAAAGCAGACCTTAGCTGTCGCAGTTTTCCTGGTGTGAATGGTG
CTGGCGGTGGTGAACGGGATAGTATTTGAGGGGGAGTGACAGATGCAAAAAGCCACATCTTGTGTAGATCACTCAGGCAAGCCACCTGAGCACACAAGAA
GAAGTAAGTCTGGTTAATCCGCAAAAGTAGCAAGGAAACATGTGATAATATTGCATAGCAATACCTTCTTTTTGTAGCCAAGAAAGACTTCGGTGCCACC
TGAAGTCGAATTGAGATCAGCAATATGGCCAAGCGGAGACTTGTCCACCTTCATGTAGCTGAGAAAATATGCCGTGTTAGCTCAAACATCAAACTGAACT
GGTTACAAATACTCACCCATACGGAAGCGTCTCGATTTTTCTCGGGAATAATACAACGATGTCAACGATTGCAGAAGTGGTAGATCGCTTAAAGCAGAGG
TATATCTTTTCCCCTTGAGTCCCCTATTCAAAGTACACAGCGATTAGATACTGGAATATATAGATGCTGCTTTAAGCACGTTTTCTTTACCGTGTTGATA
TTTGCAGGAGCTCCACGCCTTCGGACCACCTCGTAATCACTTGGAACGAACTCACCTCGTTCAGGAAATATGGCAGTGATCTCACTAATCGGAGCCTTTC
CTGATGATTGATCCTTGCTGTGACACAGATAGATAAAGGATCCCCTTCCACCTTTGTTCAGATCTGCTCGCTGGCCGCTTGGTGAACGTTCCAACTATTC
AATGCATTGGTGTGTTAGCTATAGGGGTTAATGACTACAGAAAAATCTCAATAGTGCACCTTCGTAAATCCTTCTGGAACGGAGTCTCCTCTGAAAATGA
CCGTAATATCTGTGATAGGGTCTTCGTTCCCGTCAATTATCTTCCACCGTGGCGTTTCACCTACAAGAGTGCTAGATTATACATTCATTAGCAACAGAAG
TACCGATTCCGGTTAAGAGGTAGTACCTGTCGTAGCTAGGACGTCGACTCAATTTCATTTTTCGACGTTCTTGAGGACTTTTCGACGGGGATAAAGCTGC
TGCTGTTTCGTTTCCAACTTCACCATCACTAAGAGCGTCCGTATTGTCATTATTACACTCCTGGCGATTAACAAAACTCTTTGTTGCGGTCACTTGGTCC
ATTCTTGCCACCGTTTTTTGGCAAACCTCTCGAATGCACGCGAGTTCTTCATCATCACCTGCCGTCTCGTCCAAGATCGTGTTGATCCCGCTACGTAACG
CCGCTTCATG