Description :
From Genome Similarity Track
Location :
Scaffold_1:385579- 386835
Transcript NameFunction/comments
Aphas_H257_00138Mitochondrial Processing Peptidase alpha subunit

Sequence
1256 bases(100 bases per row)
ACGTCCTTCTAGGCTGCCGGTGCTGAAACCCGCGAGTCAATTGCAAGCTCCACGAACAGAGACCACGGTGTTGCCGAACGGCCTTCGCGTGATTTCACAA
GAAACGTACGGCCAAGCGTCGACAGTGGGTCTGTTTGTCGACGCCGGCAGTCGCTTCGAAGACGGTGCGTCCTCATAGACGTCAAGCAAGCGTCATACCT
CCACAAACAACCCGCACATCTTCTTCATCATTTTCATTATCCATCGTAACGATTCGGATGATTCTCGTAGACTCGAACACTGGGGTCACGCACATGATGG
AGCACTTGGGGTTCAAGAGCTCGCGTTCCCGTAGCCACGCCGACCTCGTTCGGTAAGTGTCTTGGCTCATAGGCTACTAGTTCCCTCTGTTAGTATTACT
ACCGTTTCCATGGCATATTATGTCTTGGATTGATGGGCTCATCATATACGATCCTAGCGAGTTCGAAGACATTGGCGCGCAGACCACCGCGTCCAGCGGC
CGCGAGCAGCTCATCTACACGGTGGACGTCCTTCGAGACAACGTGGACAAGGCCCTGGCGCTTCTGGCCGACGCGTTCGTCAACCCTGCAATCCTGGACG
ACGAAATCGAAATGACCAAAGTGATCATGAAGATCCAGTCCGAGGACCTCAAGGAGAACCCGCAGCTGTTCCTTCAAGAGGTGGGGGGATCTTCCATATA
TCCATCATTCAAGTGTTCACGTCGAGGTGATAGCGCGTCCACACGGCGGCGTACGGCGCGCACCACACGTTAGGTCGGCCGCTGCAGTGCCCGCTGGAGC
ACGTCGACGCCCTGGACCGAACTGCGGTCACTTCGTACATGAACAAGTTCTTCGTCGCGCCGCGCATCGTCCTCGCCGGCTCGGGCATCGAACATGCCGT
GCTCGTGGAAAAGGCCAAAGAGTACTTTGGCGCCCTCAAAGCGGAGGCGGCGGACGACGTCGCCCCCCTCGAGCCCGCCGTGTACCGAGGTGGGTTGGAA
GCCATCGAGAACGCCGACGCGCCCTTCTCGTACGCGTCGCTTGCGTTTCCCACGGGCGGATGGCACCATGAAGGTACATTTTGTTCATATGATTTTTTAA
ATAGATCGACAAAATCACCTTATCGCAGATGTGGACTCTAATGACATGGATAACATAGATTTGGTGCCTGTATGTGTGCTCCAGACGTTGTTAGGAGGGG
GCGACTCGTTTTCAGCTGGTGGACCTGGCAAGGGCATGTACTCGCGCCTGTACACG