Description :
From Genome Similarity Track
Location :
contig_45:385462- 387170
Transcript NameFunction/comments
g8128.t1hypothetical protein

Sequence
1708 bases(100 bases per row)
AAGCTGCCGCTCGAGCTGGAGCCGCCACGGGATGCAGCGTTGTACAAGGCCCATGAACGGGTGAGACCGTCGTCCATGGTCGCTGTCGTGAGCCTTGACA
GCGCATCTGCCTGATTAATCGCCGCTTCGTTAACAAGGAGAAGTGACAACCACGCATTGCTAGTGTTGTCACCCGTGACAATCGCCTCCTTCGACAGGAT
GTCATCCCATTCCTCCTGAATGAATGCAGTCGTGCGCACCAGACCATTGATCGGTGACACAGGGATCATCTGGATGCCGTGGATACAGTGCTTCTCGGCA
CTGAACCACGTCGCGTAGTCCGCCTTATTGTCGAAGAAGATGCCCGTGACGTGGTTGGGCACGAACTGAGGCGGGTGAATCGTGTTGTCCGACGTCATGA
GGAAGTAGGTGCGCACTGTACGCGCGTTGAGGCGCAGCATGAGGCTCCCCAGGTCCTCCACCGCCTTGTTCCCCGCCGCCTTGCCCCACAGCATCATACC
GTAGTAGAAGTTCACATCCTCCGACGTGCTCTCTTCATCCTTACCATCAGCCATGGGGGTCACGCCGTGCGAGTAGGAGTGACCCAGAAACCAGGAGAAG
ATGGCGGAACTTGGGGAAGTGTGTGTCCTCCGAGGCTCTGGCGGGTTGGCCACATCCGCGGGAGCAGCGTTCCACACATCGTCTCGAGTTGAGCCATGCC
TGACCATGTCGGATCCAGCTTTTCAGGATGGCCGACGCCGCTGTGATCCAGTAGCCGTAGTGGTAGTGATGGTCGTTGTACACTCCGTTACCAAACTCTA
CGTTGACATCATTGTTAGTGAAAACCTGGCTTGTCACAATGCCCTTGTACGTTGTCTCGTACACCAATGGGACGCTCAGCGTGTTGCTGACAAAAGGTTC
GATGAGTGCCTCCAGCTTCGACAAACAACTACTCAGGAGTGTAGTGTCATCTCCCACCACTGAGCTGTCGGCGGCCATCAAACACAATGACGCGTACTTC
TGGTACGCCTTGCCGTTGTAGTACCAGCTGCCAGTGTCCAAGCTCCAGTCACTGTCAATGTCGCTCTGCAGCGTGGCGAGAAGACCAATCTGCGAGACCA
CGTCGGCAGACGGCTTGTTGGCTGGGTAGAAGTCCACCTCGTCGTCCGCTTCGTCCTCCGTCAGCGTCCAGCTACCAGACGTGGTTACCTGACCCACCAT
GTCACCGCGTGTACTCGAGTGCAAGACAATTGCTCCACTCGACTGCGCCGCCGTGGCACTGCTCATGACCTCCACTTGGTGCGGCAGTGCAAAATGCAGA
AGACCTGTGCTGTCGCACCCACTGCCTTCCGTCTCCCACTCCAGCGAGTAACTCGTGCGAGACTGCACCGACACGTCGCCACCGCACACAATACACGACG
CGTAGTCGTCGTACACGTCCTGATCGCTGTTTTCGGGAAGAATTGCCACCCGTAGCGTGCCGGTGTAGGCGGCCGCAGCCACCAGCGCCGACCCCGTGCT
GTCGATTGAGAACGACGCGCTGGTATCGCTGGCAAAGACCACCCACGTCTGGCCGTTCGCGAGCTGCACGACGAACTTGCCTGGCGTCGAGCTATCCAGC
AGTGTCATGGCGTAGTCGGACTGGATGCTTGCGGTGAGACCAGCGTACGTGGCCGACACGAACGCCATGCCGTGCACCAGCGCCGAGTCCATGCAGGTCG
TGCTGCTG