Description :
From Genome Similarity Track
Location :
Scaffold_10:385414- 386444
Sequence
1030 bases(100 bases per row)
GATCTTTTCTGGATCGGGCCGGAAGCCATGCTTGCCCACGATGCAACCAAGAAGTGGTATTTCGCTAGCAGCAAATATACACTTCTTGAGGTTGGCGTAC
AACTTATTCTCGCGCATTAGTGCAAGAACTTTCCGGACGTGGAGTCGGTGCATTTCCACATCCGTCAGTCCATCCATAGCCCGGATATGGACGGACATTT
CATCGAAGTAACTGGGCGCGAATTCTCTTGCGGATATCAACAGATTCGTTACACATCTGTTGAATTTGGCAGGGGCATTGCTCAGCCCTTGTGGCACCAC
TTACCACACCCAAAGCATACCGCTTGGGGTGCTCACTGCAGTATAGGGAATGTTCCGTACACGCATAAGGATCTGATAGAACCCATCCATCAAATCCATG
GATGAAAATATGGTACTCTTAGCCATACCGTCTATCATGACATATTTCCTTGGTATTGGTGTTTGATCCGGTACAATGGCAGCGTTCAACTTGTTGAAGG
CGTGTTCTATCCGCCACCCTCCTGTGGCCTTTCACACACAGAAGGTCGGAGAGCTATGTGGAGAGGTGGACTCCCTCACGTGGCCGGCTGCTAAGCGATC
TGCAAAGAATTTTGTCGATCTCTAGTACTTGTTCACGAGGCAGTGGCCATTGCTTCATGACACTGTACTTCGAACCCGGTTTCAGGTCAATTTCGTGACG
AGTACCTTTGTCCTTAGGTAACTTGCACGGGACTGCTTCTGGGAATACATCCTTGAATTCCATCAAATCATCGTGGAGAATATTTGCTTTGAGCGATTCC
CACGATTAGGATGTATATCGCTCAATTCGAGTCTTCTCATAAAGGACATTCTCGTCAATTGATGAGATACTGAGAACTCGTTCATCTACGGCAAAGACCA
TTGCCTATCGGATATCGCTGATGTACTCATCCTCCGCAGATCTGCTTGACTTGCCACTAAGCAGATCACGCAAGAACCTCTTTTGGTCCAGTGGGGGTAA
CTGAGTGATCTCCGAAGTTAATTTCAGAGG