Description :
From Genome Similarity Track
Location :
Scaffold_566:3854- 8234
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_566-snap-gene-0.7TATA-binding-protein-associated factor 172

Sequence
4380 bases(100 bases per row)
CCCAAGCACATCAGTGACCATGGCAAAGCTGTTTGCCGACCTGATGGAAAGCATGTTTGACTCGAAGTGGGAGACACGCCATGGTTCGTTGCTGGCTGTC
CGGCAGATATTGATCTCGTCACAGCTGTCTCGTTCTGTCGAGAGTCTATACAACCCTGATCACACACATGCGGTGCTTGTGAAGGCGTGGTTGGAGGAGT
GCTTGATTCGCTGCGTTTGCGTGCTAGCGCTGGATCGATTCGTGGACTACTCTGCCGACGGGTCGATCTCCCCTGTTCGCGAGCTGTGTGCCCAGATTTC
TGGCGTGCTTCTCGGGTGTCTGAGCAACGTCGGCAGCCTCTTGGAGTTCTTGCGCGTGTTTCGTGTTCTGTTCGACGGGCTCACATGGCATGCGCACCAC
GGCGGCTTGCTTGGACTGAAGTATCTCGTGCAGGCTCATACGGTTCACGCTGTCGATTTCGTTTCGCTCATTTTCGACGATGTCGTCCTGGCGCTTGAAA
CACGGCCAATTGAGGAAGAGGACGTGTTGGTAGTGGCCGCTGAGATGTTGGAGCAATTTGGCCCGTACATAGAAAACGTTGAGAGAAACCAAATCAAGAC
CGCGGCCCGATTGCTATGGAATGGCCTTACTCAGGAAGGTAACAGCGGGCTCGTTCGCGCTGGGGTCATCAAAACCTTGTCTGCTTGGTACCGGTTACCA
CCGTTAGCGAACATTTTGAGGCGCGACAAGGATATCTATCCGACCGTATGGACGAACTTGACGCTTTCAATCCCGCTGTTGCATCATCACTCGGAGTTTG
TTCGGCGGTCTACAGCATCCTGTGTGGCTTCGATTTCCAAGCAAGAATGCGAAGTTGACTCTCGTACTATTCACGCGTTTTCGTGCAAGTTTCTGCCTCA
TGTACTACTGCAGATTGTGGCGGAAACGCAGGAGTCGTCCATACCGGGATTAATGGATGCCTGGAAAAGTGTTGTTGAACTCTCCGCCGAACGGGACTGT
CTTGTTCTGACCGTGTCCGAGCGGTTGACTGAGTGGATGCGATTGCTGTGGTCGAGCGACTCATTGGCCGCTTTGAATGTTGGCATTGGAGATGCTGCCG
ACTCAGTGACCGGTGACAGGTCGATGGCCACCACAAGTTTGGAGAGTCTCAAAGGATCAGTATCTTGGCGTGTTACGTTCGCTGACGCGATCGCATTCTT
GGCTTCGCGTGTGCCTTGGGAGAGCTCCTGCATGAACGAGCTCCTGGATGTGCTTCAACGGGGTCTGTTTTCCGCGTGTGGCGAAATACAGTGTGGGTGT
TTGCTCATGCTTTCGAGGTGGGCGTTCTATCAAAAGCAGTCGCAGTCAGATGATCTGTCACGACACCAGCGGCTGCAGGACAGGTTGGGGAAACACTTGG
ACGATTTCGCGAAGAACCACTGGAAACCACTTGCGAGTTGGTTGTGTGCGAACACTGCTCCTTCGACTGTTTTGTACGAAGAGCAAGCCAAATCAGTCAC
TCGCGCGCGCCAGATGCAGACTCGAATCGTGGAACTCTTCACATCCGCAGGGATATCTGTCAAGCCCACGGACCACCAACCGTCCAGTGTGTTGGCAGCA
GCGGACATCTCCAGGATCATAGCGGAGCAAGTTGCCTCGTTGCCGTTCGAGAAGCTTCAGACACACTCGGCAGAGTATGAGATGGCTCATTTCAAGCGCC
AAGATTTGTTTCTCGTGGACGAGTTGATCCAGCAGACGTTCTCCCGATTGTACAGTCGTATTCAAGGACTCGGGAGCTGTGCGTACTGCTTTCTACTGGC
CATCCCTCCAAAGAAGAGCGGCTTCCTCGTTTCAGCATTGATGGAGTCGCTGAAAACCGAGGAAGATCCCGTTTTCCGCAATCTGACTGCGGAGGCTCTG
GCCGATTTTGTGCTGAGTCAAGCTGCGACTCAAAAGAAGTGTGTGAGCAAGATCATAACCAATTTGTGTAACAGTGCGACTGCTCTGGGAAGTGTTCTGT
TCGGTGAAGCATCAGCCTTTGGAGGTGACCATGCAACGAGTATTGCTTGCTGTTCAACTGAAGATGAAGACGTAGCAGCACTTCCTGCAGATGTGAGGGA
GAAGATGAAAGTTCGCGTGTTCGGCGCGGTCAGTGCCTTGTTTGCTATATCGGCCAAAGGAGGTGTTTCTCTTTTCGATGTGTGCCCAGTCTTGGAATCG
AATATCTCGAGCGCGTGGCAAGATGAACAGGGCAACGAACAATCAGTTCAACGTTCCATGCATTTGATTACTCTGTTGACTCCGCGGCTTCATCCCGAGT
GCGCAGAGACACATTGCCTAAAGTGGCTGGATAATTGTGTTTCTTTGATGAGAAATCGCAAGTTCAAATCGCCCCACACCAGTCACTTGATCGCACAGGC
TATCGCAGTAATTTGCAAGTATGTTGAGGCTCGCCGTGAAGACGCGATGGCTCTCATCTACAGTCGCGTGTTCCTAGTCTTGTCAACCAACTCTGGTTCA
GAGACTCCTCACGACAATTCGCAGAATGTGTTGGAGGACGCGATTATCGTACTGGACCGCATTGTACGTCTGCTGAAGGCCGACGTGATTCCGTACATTC
CAAGTCTCGTCCGCTACGCGATGAATACAATGGCCTCTCAGCACCGCAATGTCCGTGTGGCTGCGGCAAGGGCGTTCGCTGAGCTGGTCCCGTTGATTCC
ACTCGAGATGGATCTGCAAGAGCATCACGCTGCAAATGGCAAGTCTCTGCAACCGATTGTGCAGGAGAACGAGGTGTCGCGACGATTCCTCGAGAGCTTC
CTTCGAGGAACTGCGATCCAGCCTACGGATGTGCGTCCATGGTTGGCAGAGGGTGTGTCTCTCCGCCAGTATCAACAGCACGGTGTAGATTGGCTGTCGT
TTATGCTGAAGAACAACCTTCACGTCGTTCTCGCAGATGACATGGGTCTCGGTAAAACCTTGCAAACGCTGGCGGCGATGGCTGTCATCGTCGACGAGTA
CAGCAAGAAGAAAGTTTCCTCAGGTTCAACAGGTGTCCCATCGAGCGTGAGTCTAGTTGTCTGTCCTCCTATCGTTGTCCATCACTGGGTTACAGAGACG
AAGAAATGTTTCGCTGACGTTTTCACAAGAGTTATTGACTATTCTGGCCCAGCTCATGTGCGCAAGAAGGTGTTGCAAGGCTCAAAATCCTTTGGTCAGT
ACTTATCTGAAGGTGGCCATGTCTTGGTCGTAACGACCTACGCTGTTCTGCGGAGCGAAGTCGAGCTCTTGACCGAGCAACAGTATCTGTGTGCTGTGCT
TGATGAAGCACATTTGGTGCGGAATCCGTCAACTGCCCTGTTCGGAGCGGTCCAAGGTCTTCGAGCAATGCACCGAATGGCCCTCAGTGGAACACCCGTC
CAGAACCACGTGGGAGACCTGTGGCCACTGTTTGAGTTTCTGATGCCAGGCTACTTGGGCGACGTTGCGTCGTTTCGTCGCGAGTTCGTTGTGCCCATCG
CGAAGTCCAAGGAACGCAATGCAACCGGGAAACAAAAGGAAGCGGCCGCAATCGCAATCTCACACCTTCACGAGAGAGTTCTGCCGTTCATTTTGCGGAG
AACGAAGGACGAAGTGCTGCGCGAGCTGCCACCAAAGACGATCAGCAATGTTCTGCTCCCGTTATCAAGTGTGCAGAAGCGGCTCTATGCCATGCTATCG
GCGGCGTCGTCTGCTGGTGGGAGCACGGATAACGTTCGCACAGCGCATGTGTTTTCGGATCTGCAGTTGCTGAGACGCATCTGTGTGCATCCGTCACTGG
TTCTCGACGAGCGTATTGTGCACTCGATCAGCTCAAATGACCGAGCAGCAGCTCGAAAGTGGTCCTCATCGGGAAAGTTAGTCGGTCTGCGCGACTTGCT
TGTGGAGATCTGCAATGTCGGCACTGGTGACGGCGATGCTGGTGATGCTGGTGATGCTAGCATGGATGATGTTGCCCCTCATCGCTGCTTGGTGTTTGCC
CATCTCCACGATACACTCGATCTGACCGAGCAAATGTTGAAAGACGCGCTGCCTCGAGTCTCGTATCGCAGACTGGACGGCCGCACCCCTCACACTCAAA
GAGCTCAGGTCGTTCAGCAGTTCAATGACGACCCGTCAATCGACTTGCTCCTGCTCACGACTGCTGTCGGTGGCTTGGGTCTAACGCTCACTGGCGCCGA
CACTGTCATCTTCTTGGAACACTCTTGGAACCCGTTCGTTGATCTGCAGGCGATGGATCGAGCACACCGCATCGGCCAGAAGCGGGCGGTGAGGGTGTTC
CGATTGATCATGAAAGATTCGCTAGAGGAGCACATTCTGAACCTGCAGGTGTTCAAGCAGCGCGTTGCCAACACGGTTGT