Description :
From Genome Similarity Track
Location :
Scaffold_4:385394- 386921
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_19259Hypothetical protein

Sequence
1527 bases(100 bases per row)
GTCACCTCGTCCCGCGGATCGCACTCCTGCCTCCGCCTGCCTAAATCAAGTTCCTCAACCGAGTACACACAACGAAGAAAGTCCGACAAATTTATTTAGC
ATAGTTCTGATAGGAACGTTACGTTAGGTATGGTGCAGTCCGTGGCACGCAGGTTCGCTTTCCACTGCGCGTTATGCGTGGTGCTTGCCGCTTGCGGATC
GTCTTGCTCTTCTTCATGGCTTGGAGGCGCTCGACCATAGTTTTGGACGAGTATGCATCGACCTCGTCGTCCGAAAAGTCGTCGTGCGGCCGCTCAATGG
TGATCGTCACGGGCTCGGAGGCGTCGTCATCGTTGTTGTGCCGCGTCAGCTCCAGCGTAGTCTTTGGGGGGCCGTCCAGGAAGGCTTGGATAGCGGTGCA
CATGGGTGCTGGTGCGCGCAAGACGTCGACCAAAGCATGTTGGGAGCTCATGAAGGTGTTGAGCTGCGTCGCGAGCTCGCAGTCGCAGTCCACACGCACC
TCAACCTTCGGACGCAGATCACGGAGCCGACGCCCGGCAAAAAGTGGCGTGAGGTTCTTGATGCAGAGGTTGGCGAGGAAGAGCCATGCCTCGTGGGTCC
AAAAGGTGTGGCGAAGAAGGCAGTTGGCGACAAAACCACCATACATCCACGGCTCTTGCGAGAGCACTTGGTCGTTCCACAACCGGACGTACGACAGCAT
CTGGCTCGCGTCCATCTCGGCAATCAGCTCGAGCGTGTCGACCGCCAGTCGCCAGCCAGCGTCCACTTCTCGCGCATCGTCGTGGGATGGCGCGACGTAG
GGGTGCGGATGGTCACGGTAGTAGTCGTTGAGGTGCCTGTCGTAGTTTGTATCGGTGTTTGTGATCGGGCGCAAGACACTCTGAAACAACAGCGCGCGCG
TCGCATTGTCCACAGTAATGTCATGCGCGAGGACGTCGCGGATGGCGGGGACGGTGCACGAGCCAAAGACGGTGCGGCAGCGCTCGAGAAGCGCCGACGT
TAACGTACCATCGCAGAGTGCGATCGTCAAGAGGCTTCTGACGATGACCACGGCGTCGGAGTGAGACCACTCGTCCCGCACAAGCATGTCCACGGTCGTC
GACGGGTTGTGGAGCTTGGCAGCAATGGCAGCGGCGAGCGCGGGGACACGGAGGCGTCGTTGGAGGCGCAGACCGTACACCAAAGCAGGCGCCGCCGTGG
TGAGGAGCGCTACGCCTTCTGTCTCTTCAGCGTCCAGCAAACGACGGGCCATCGACTTGGCTGGGTCGAGGTTTGCGTCGATCGTTGCCAGCGCCAGTGG
CGGCAACTGCCTGTGAAGCCAGTGCGATGACACACCATTCTCTGCCACGTACGCATCGAGAACGAGGCAAAGGCCGAGGACCTCGTGCTGGACGGCGAGT
CGCGCGTTGTGGTAGTGGGCGTCGAGCGCATGACGCGACGTGCGGTAGAGTCCCTTGATGAGCTCAATCGTAAATGGCTGGTGGAGGGCAGGGCACACCG
GCGTCGCACCATCCACGCCCGCGAGCG