Description :
From Genome Similarity Track
Location :
Scaffold_18:38535- 39909
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_18-snap-gene-0.27Protein kinase C binding protein
Pytar_ATCC12531maker-par_contig_18-snap-gene-0.38Metal dependent phosphohydrolase

Sequence
1374 bases(100 bases per row)
TCGGCGCGCACCTCGCAGCGTCCTCCACTTCGCCTTCCTTGCCTGTTCGCTTCTCTGCCGCTGGCCGCGTCGCTCGCATGTCTTCAAGCAGCGGAAGTGA
CGAACGCGCGCGCGCCGACGAGGCCGCCACGCAGCGTCGTGACGACGGCGCGCCCACGATCTTCGACAAGATTCTCGACCGCTCGATCCCGGCCAAGATC
ATCTACGAAGACGACCAATGCCTCGCGTTCCACGACGTGAACCCGCAGGCGCCGGTCCACTTCCTCGTCATCCCGAAGCACCGCGACGGACTCACGCAGC
TCTCCAAGGCCGAGCCGCGCCACAAGGAAGTGCTGGGCCACTTGATGTTTGTCGCGCAAGAAGTCGCTGCGAAGGAGAAGCTGGACAACGGCTTTCGCGT
CGTCATTAACGACGGCCGCGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCAGTCGGTGTTCCACCTCCACCTCCACGTCCTGGGCGGTC
GCACTCTCGGCTGGCCACCTGGATAGGTGAGTGAGGGGGCTGAGTCCGTGGACTTTCACTTTGTGTGGTGGGGTGGCCATGAGAAAGCCAATCGATCCTT
TTGAATATTTGGTGCGCTTCTAAATACGAAGTGTCTTATGATGGCGGGCAAATCTACCCACGACCTTCAATCTCCTTGAAGAACTGGACCACAAACTGCT
CCATGAACGCGTGGCGTTCCTCGGCGATGCGCTTGCCGGCCGCGGTCTTCATCATGCCCTTGAGCTTGAAGAGCTTTTCATAAAAGTGGTTGATAGTCGG
CGCCTCTCGGCTCTTGTCCATGTACTGGGCCTGGCTCACTTCCTCCAGGAGCGGCACCTCGGGGTCGTACAGCGGCCGTTTCTTGTGGCCGCCATACGTG
AAGCAGCGCGCGATACCCACGGCGCCGATCGCATCCAGTCGGTCAGCGTCCTGCACGCAGCCAAACTCGACCGAAATCTCAGCACCGCTGCCTGCCAGCT
CTTCCTTGAAGCCCATGCGGTTGATGATGTCCATCACTCGAGTGACCGTGTCGTCGGGAACTTGATGCGAGCGAAGGAAAACCTCGGCGCGTTTGGTCTT
CACGTCGTCCGTCTGGTACTTCCAGTCGTCAATGTCATGGAGCAGCGCAGCAAGATCCACAATCTCTAGGGACTCGGCGCTCAGGTTCTGTGTACAGGAA
CAGAACGGTTAGTGCTGTGAAATTGGCGGAGAGCATGGTGGCGCGACCCACCTCTTCCTTCGCGAGCGTGCGGGCGAGCGTCCAGACACGTTCGATGTGG
CGCCAGTCGTGAGACGCGTCGTTGGATTGCAGCTGGCTCTTCACAAACCCGGCGGTCTGCTGGACGAGCGGCGA