Description :
From Genome Similarity Track
Location :
Scaffold_188:38528- 40006
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_188-snap-gene-0.16Conserved gene of unknown function

Sequence
1478 bases(100 bases per row)
GCTCAATGAAGCTTGGCGCTTGAACTgATTCCCATGCACGCTACCATACACGAGTTGACCATAGAGAACAGAGCTCAGTATCGAGGCATCACCCGGCCCG
CTtttGCAGtCTTAAAAGGCTTCGGACTCGACAGAGGATTGACGTTCACAGCCGTGCTGCGTCCAGTCACGAAGGCTTTGCCTGACATCGTCTCACTTGC
TTGTTAGTGCAGCTGGCGTACAAAATGGAAAATCAGCGCATTTCAAATCCTTGACTCAGCATATATGCCCTTCGTGTTGGTGCTGCGTTCTGGGTGCCTT
TAGAGATACATACAGCACgaCGAGATGCCTGATCATCCTCCAgCAACGCATTCGGGAACCGATGAACTGCCTACGCTCGTTCGTGTCGGTCAAAGCAagA
GGAtGGTACTCGATTGAGAGGCTACTGGCGCTGCATGAATACTCCGAGCGCACATCTTGGGTGCGAGTTGTTGCGGTTCTCATTTTCATTCCACTGCTTC
CGCTCTGTTTAGTCgCAGCATACGAAGCCCCATATCTGCAACCTCCAGATGCTGGGTGGCGGGctAActGGGTCGTGTTCGTCGTTCGCTTGGGTTGCGG
CATGCTGATTGGCAGCGACGCTGCGTCGTTCACTCTGCGTTTCCTCGTTCCCGAGTTTTGCGAGAGCATTTCCCGTCCAAAACGTATTGCTTTCGCCATG
TTCTCCtccGcGATCTATGCCGGTTTCGCGGTTCTGCTAGCGGTAAATGGGGgTTTCCcATACCATTCTTGCCATGCAtcGCAAATCCAATTGCAGGACT
AGCGAACCAGCTTGCGACCTATCTCGTTGTGCGgCACGTGGTTCaCAAGCATGAGTCtcttcaacgtcGTTTGCTTCtCTTTTtCCGTCATGCTACGGTA
TGTAAaGGAGTAGCAGTtGTTTATCCGGCATACCTCGCATTGTTCTACAGCGTCGGTAACAAGTATCCACGACTCCAGCCAGGCGTAACACTCTTGGTTC
CATTGATCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGcTtCCATCtCCATCGCTCTCCCCAAATGGCCCcAAG
AAACCTATGCGACTGAGCGGCAGTGGCATCTTCACCACGAATCCgaGGAAGGAGCTACGACGACGAGCGACAACCTTTCGATCTGCGAACCTGTCGAGCA
TTGTACCGATCAGCCCAGGCTCTAACCAaaTACTCGCTCGAGTAATGGGACCAACGCGGAAAGCGACACTATCTCACG