Description :
From Genome Similarity Track
Location :
Scaffold_20:38525- 47232
Sequence
8707 bases(100 bases per row)
ACGTCACTCTTATGCATAAACATTCACTTCTTCCTCCTAATCCACCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCC
TCCTCCTCCTGACCCACACCCTTCCTGTGGGTCCTTCTTCATCCTCCCATCGATATGACCAACTCACATCCATGGGTCCCCTCCCTACTCTTCTTCATGA
GACTGCATCACGCCGAATCTGTTACGATTCGTACGATCCCTCAAGAAATCATAGAGTAATGCTCCACAGTTCAGATCTGCCTCGTCCACCCAACTAGGTT
CGTCATATCCACGCCAATGCACCAGAAACTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCCGATCTCATATCGGTGATCTTCTCGACTTCGAACTC
GTCGGCTTCGAGATCCACATTCCAACTGTCTTCCGGTAGGAGAACTTCGTCGAAGTCGACGCGGTCGGATGCATCTACCGAAAGACGGATCTGCGGCCGA
TCCGGATATTCTTTGACCAACTTCAGCTTGGATACGTGTACTACAGGGAACAGGCGATATTCGGTACCTGCCGTTTCCAGCCTCACCGCATGTTCTCCAA
TCTTCTCTCTCACCCGGAACGGTCCATGCCATAGATGGGCCAATTTGCGAGCGTACCCTTCTTTCACTCGATCCAAATAAAGCCACACCTGCGATCCCAC
TTGGATTTGATGTGGACGGGCGTCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCATTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAG
TATTTCTGGACTTGGTATCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTACTGCATACTGGAATGGCCGCTTCTAGGGTGGATTTGGGATCCCACC
CATGTACCAAGTAAAATGGTGTATCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGGAGCCGTTCTGCGTACTCATCCCAATCCCTTTGATC
CAAATCCTGGACATACATCTTGAGTGCTCTCGTGATCGTCTGCACCATGCGTTCGGCCGACCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGT
CGCTGCCTTAGGATCCGGTTGAATGCTCGAAAGAAATCAGACATAAAGCCTGGCTCCCGATCATGTCTAATCATTTCGCTAGCACCAAATCTTCGGAAAA
CACACTCCTCGTACGATTCCGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCAATCACATATCCGGTAAACAGGTCCACCCAAATCAACAATTC
TGTGTTTCCTTTGAACGACTTGGGCAACGAGGGGATATGATCCATGGCTATGATCTGGAAAGGGTAAGTCGCTCGAACATTCCCAGGTGACTCCCCTTCG
ATCGTAGGTCTGCCCTTGCCTGTCTCACAATCCACGCATTCACCGACATATCGTTGTACACTCTTGAATAGTCCTCTCCAATGGAAACATTCCCGGATCC
GTTGGTAGGTCCGACCAATGCCCTGATGTCCGCCTTCCAAGCTAGCGTGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAATCTCAT
CAATCCATCCCGATCCTCGTGGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCGTTCAGATCCACTGCGTAATCCGTAGCGATAACGCTGTAGGAT
TTGGCATCCTCCCGACTTAAGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCATTCTGTGCTTTGAGGATCCGCTCGA
TGCGAACTCTCTTCACGAATGTTTCCTCGAGGATCGGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACAGCCATCACCTGGACTGTCCTTTTCCC
GGATCCAACTACCACCACTTCGTCAAGTCGGTTCAACGTAACGAGATCCTGATGTTCGGCTTCTCCCTCCACTTCGACACCACATTGATTCCGTAAAGCG
GCACTGGCCAAACTATCCGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCAACCACGCAGGTGGATCATCACTTTCTGCCGTA
ACAGTGTTAGGGCCGGGGCCTTGCAGTCAATCTCACCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATTACCAGCCGTTTTGGATCTTGTCC
CTTTAGTAAATCCAAACCCAGAAGGAGTCCGTTATACGCCGCTTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCG
GGCAATCTCCACAGTATTGCACTGTATGCTCCTCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCG
TCGGGATCGGGATCTGGATCCGGCGTTTGGGCTCTTTCTTAGGGGCGATCCTAGTCAGCGCCTCATCCATCTTAGCTCGAGGAGTGATGCTCGCGGCCAA
GACTCCCAGGATCTCGTCTTCCCCTTTCGAACATTTCACAATCTCCAGCGTCCAAGGTGAGAGTAAAGCCGCCCACTGTCCCAAACGTCCTTGCAACCCG
GCCGACTTGAACAGCCAGGCTAGCGTGGAGTGTCGAGTCAGGATCCGGATGGATCTTCCCACTAGCAGGTTATAATTTAGATCCAACACGCGCAGGAGCG
CGAGTATCTCTTTCTCCACCGCTCCGTAGTTCAGTTCATTCGGCTTCAATGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTAC
CAGAGCCGCTGAGACCGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTC
CTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCATCGAGATTCTGCCTTTTCCATGTTCTGATCCGTCGTCTCTATCCAGACTGGATCCTCTCTCCGTT
GGTCCTGGGGTGGATCCAGCTCCTGTTTTAGGTCCTCTTCTGACGTCATACCACTTGGATCTCTTCGTGGATCCGACATCTCCCGGGCCAGAGCTTGTTG
GATTTTCATCCGGACAGCTGGAGCGGTCATCGCAGCAAAATCTACCTCTCTTAATTCATACAACACCGCGGCAAACAGGGCGTAATCTTCGATGAGCCGA
CTGTAGTAGTTCAAACTGCCCAAGAAGGATTGCATCGCTCGTAACGACTGTGGGAAGGACAAATCGACTAATGAAGACAGGTCCTTAGGATTCGCCTCCA
ATCCCTCCTTGGAAACTCGATGGCCCAAGTAATCCACCTTGCGCATCCCCCAATAGCTCTTAACCACACTGATAGAGAGATTCCACTTAGTACACGCCTC
CAGTAGGGATGTCACTCTTTCGCACAACTGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGACGGGGTCCCA
GGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCTGCGTCACCTTCCCCGGATCCACCCGTTTCGGGCTCCGGTATTCGGGTGAACCCATAGAGGG
CGTTATCGATGAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCAAACGGCATCCGGGTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATAT
TGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAAATCTTCCAACAGCTCATTG
ATCAGAGGCATCGGATACACCATCAATCGAGTCAGGCTGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGATGATGATTA
CCACCGGCGACGCCCACGGGGACGTTGAGAAGCTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGATCCGACAGTTTTTCTCGGAACTGAGGTGCCAC
CTTCCGCACCCTTTGAGCGATCGGTTTCGCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCGGCGGGCGGTAACGCATTACCCTTACCGATCAGC
AGATGTCGGCTTTCCCAGATCTTCTGACGCAGACGATCCACTTCAGTGGGTTCGTTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCCTCTG
TGGTCAGTGGTACCTCCGGGATTACCGCCATACCTTCTCCAAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGTTCATCTTCGGTCTT
TGTCTGATCCACCCTTGGATCCAGGCACCGCGACTCTCCTTCGACCGTCATCCCTTCTGTCTTCGTGGGGTCGGGTATCCTGGTACTGGGGAAGTCACCG
GTCGGATCCAGCCGGTCCTCTAACGAGTCTAAACCCGACGGTTCGGGTTTGACTAGCGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAGTGGAA
AGCTTAGATCCACTTGTGGATCGGCGGGATCCGGCTGTTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTG
GGGATCGTCCCCCGTCATGGATCCAACCTCCATTGCTTGGATCTCAACCCGTCGATCTCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCC
ACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAGAGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGC
GGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCT
GACGTTCGTGACCTGGAGGTATTGCGATCGACCTGGTCCTTGGATTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACC
CACTTTAACCGGTCTGACAGCTCCCAAGTTTCCCCGGGCTCGATCCAGGTGGTCTTATCCGCCCTTATGATCCTCATCTTCGCTCCATACAACGGCCGCC
GTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCCAGATCCAACCTCACTCCGGCTGGCACCATGAAATCCATCCCAAGGAT
GGCGTCTTGACCAGCGAGATCCCCGACCCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTAATTCGCGTTCTCCCGTTTGTACGGTAT
ACGCCTTCTCCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCAC
CACTATCTAGAAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACG
GGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTG
GTAGGCTCAAACCATCGACCATGTTGGCGTTTCTCCCAGTAACCACGTGTCTCTCCTCTTTGTAGATCCAGGGTTGAGGAGACTTTGGATCTGGAAAACT
CGTCCACTTGGCGCAAACTAGAGATCCTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGA
TGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCTGCCACTT
CCGGCAACATCCCTCGGTGCTTGGCTGGATCAAACCATTGGCGGATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACA
CCCGCGACACACGTAGAAGCAATTATCCCCGGGATGACCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGTGTGCTTCCGG
GATCCGCACTGCGAACACCTGACTTGTGCTGCCCCGTCCATGAGATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGT
TGTCTCCTGTCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGGTAATCTTCAGGGTCGGAGTCCGAGCCGTCGGATCCTGACTCAGTTCC
TGAGTCGGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAGGCGTCGGAGCCTTTTGGCGATACTTGCCGGACCCGACCGCCGCCTTCTTCTGG
CGGTGTTTCGCGCGATCCACCGCCCGCAGTACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAGCAGGGTCAGCCTGTCGGCCAGATCCACATCTCCCA
ACGTCTCGATGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAG
GTATTCCAACGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGGGCCACCGACACTCCTAATCCACAGTACTGGGTCTGGAAACTGCGCAGC
AAATCTGGCCACTTGTTCCTGGTTGATCTGCCCAGCTGCCGATACCAGTTCCTGGCTGGCCCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCAT
CCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCTCGCTCGGTCCTCATCTTGATCCTTGCCCGTGAACTCCTTCAAGTCCGA
TATGGCTGAGATCCGTACCCTCTGGATCATGGACGATCCACCTGCCCCGGCTGTGGCCGTTGCTACCACGGCTGCCGAAGTGGATGGGCCATCCAGATCG
TCTGGGTCGAACTCATCATGGGAGTTGTCCCCCTCTACTGACTCCATCTCCACGTCCCGTGCTCCATGTTCGTGGAGCACTTGCACTTGTGGCACGGGCG
CTCTCATACCCTGTTCGGCCAGGAAGCGATTCATCGCAGCTTCAAAGTGCCGCTGCAGGGTGCCCGAGGAAGTGTCGGAAGAGCCTGTGGCCGTCTGGTC
CACTGGCGGGACTGGATCCGTGAGGCGATTACCTCGAGCCTGATCTGACGATAATCCCACTGGCTTCTTGCCGGATCTGGCTCGATCCTGGCTGGATTGT
GTCAGATCACGCGTAGGGCGTACTGGATCCCGAGCTTTCACGTTCACAAGGGCTTCCTGTCCTCGGATCCTCGCCCGCGCTTCCAGCATGGATGCCCCGG
AGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTTGGCTGATCCTCGGCGA
CGACACTGGATCCATAGTACGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTTCCGCGTCGCGGATACTATGAGATCCAGGTCTAGCTCG
AAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAGACGTAATAGATTTTTGACTGCCACCAACTTGTTCGCCGTTTTCGTTG
GTGCTCCCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGATCTGCATGACAGGATCTTGATGCAGGAAATCGCGTAGAGCTTGGTGGCGATA
CACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCGCGTAGTCTTACTCGTT
TTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATACCGTTTCGCCTTCACTT
TCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAGAGGTTTCTCTTCTAGATCCGGATC
CGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGTCGATCCGACCTCCGAC
GACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTGG
TGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCCCGATGATCCGTGTTCT
GCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTCTCGGTAACTTCCGAAGAGTTCAAGTGGTGAAGCTTGAGTGTCTTGGCGA
GACGTGGGGATGGGGTGGAGCAGCAGTGGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATATTCGAGCTTATGGATCCGGGGCC
TAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGTGTTGTCCTTTAAGTCGTACTTGCCGCCTCCTGTGACGGGATCTTG
AGAGTTG