Description :
From Genome Similarity Track
Location :
Scaffold_43:38508- 40595
Transcript NameFunction/comments
Physo_136076hypothetical protein

Sequence
2087 bases(100 bases per row)
AGAGACTAACGAGGCTGCTGACTCTCCGGCGGAGTCGGAGTCTCCGAGATCTGGGCAGGGGATGTGCGGTTCAAGACTTGGTAAATGTATGCACACGGTA
CAGATCGTCTCGGATGAACTTCAAACAGAAAAAGGAGCGGACGGTCGCTGGAGTACGTGCTGCTGCGCCCGACCGATACAAAGTTGCCTTCTTTCCTCGC
GACATCACGACAGCCGGGTTGAACTTGGTCGGTCAGAGATCACGTTGCACTCGCGCCGTCCATCGGTGTGCCCCTCGGCGACGGTGAGCTTCGCGTTACG
CGCGCCAGCTTCAAGCGCCCACGCCGGCCTTTGCAAAAGCTCGCGGCACTTTAAGCCTGAGGCAGTGCCCATGCCATTAGCGTCGCGTAGTGGATTTCCT
CGTAAGGGCTACGAATATACAGTAGTATCGTTTGAAAAAGCGCACTGGTCCGCTATTTGTCGATGGAAGTTGAGGAGCTACAGAATTCTGCCCGAATAAG
GAACGGGTGTACAACTAATAGCCTCACATATTTAATATTATTTTCCAGTCGATGTGGCGATAGGGGGATGTGCAAGGTACTGCAAGGTACTGAGGTACTA
AGGTGAAAAATCCAGTGCCAATCATCAGCTAGCTCTCCACCCTCGTTTGAAAAATGGCACGCATTTAGCGATCTTACTAGACTTCAAACTACATGTACCG
TAGTGGTAGACTCGCACTGTTGCTTTTGCACCTCGCCCCACAAGCCCACCTCCTCCCCCATTCCACCCATGAAGTCCACACCGTCCAAGCGTCTCCGTCT
CACTTGGTCTGAGAAAGTGGGCATCCTCGACAAGGTGAAGGGCTAGATAATCCCTACGAGGTCGACCAGTTGACAGCGCTGTTGTGGTGCGAGGATGCCT
GGTCAAAGGTTAGTGCTTCGACCATACGCCACTGTTGGAATCATTCCGGACTCGTAGGTAAAGCTGCTCTTCAGTTCATTTTTAAATAACTAAATCAGTA
CATTGGAAAAGTATACTCAACTTAACATCAATTTATATATTCTGCGTCTTTATAAATATCAGGCGTTCCTTACTCGGGCAGATTACTGTACCGGTAACCT
ATCACCGCGCCATACATGTACATGTGCGATGGTGACGGTCGTAGAATTGAGAGTGACTATCGTCGAATTGAAAGATACTGTACCCAACAACTTCAATGTG
ATGTTCGAACGCGCCTGCGTTGGTTGAAAAGGTATCCTTTGATTAAAATCTCGTTAATGCGGTTGTATCGATATAGCGAGCGCTCCTACATCGCGAAATG
GTGTGCGTACATGCGCCCCTCGTCGGTGCTGGCGGCCATGCGTACCAGCATGAGGTTGGTTGCCGTGTTGGTGAGGGCCTGCAGTCTGGTGATCAGCAGC
ATGATGCCTCCGAGCTCGATGGGCGTGGGTGGCAGGTCGCTAACGCCGCAGAATCCCTGCCACACCGTAAAGAAGAAAACAACAGTCGACTGGGGCACTG
CCGTGTCTCCAAGACTAGCGATCAACGAGTAGCCAAAGACCCGCGCGCTGTTGCTGAAGTTGAGCGGAAGCGCACACTCTCCGTAGCTCACCGTCCACAT
GAGAACCACCGGCAAGACGATACCCTGTGCGAGACGATTGCACGCAGCCAGTACAGGGAACAGCGCGCCGAAGACGGCAGGCGGAACTTCTCGTGAACGC
AGCACGCTCTTGGTGGCGATTGCCAGCGGCAGCAGAGGAGACTGCAGCAGCACGCTGTAAAGCAGAGGCGGCATCATCTTGAGCATCCAGCCGAACGGAT
GGCGGCGAGTTACCATGTAGAACAGGATCGGACAGAGCACGAGGCATTGGATGGCGCACACGAACACGCTCGTAAGACACCACCTCCCTGCAAACGACGC
GAGCCTCGAGTTGGCCGGATCAATAAGCACCGACCCGATAGTGAGTGGCAGGATGGCCACGAGCGCCAGCGACTGCAGCCAATCCAAAATCGTGAAGAGC
GCGGCGTACATGTGCACGAAGAGTCTGAGCAGCGGGTTGCGTCTGGCATCGCCGCGATCGCGACCAACTCCTCCACCGCGGAAGCTG