Description :
From Genome Similarity Track
Location :
Scaffold_39:385037- 387897
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011941Similar to CORO1B: Coronin-1B (Pongo abelii)
Pytul_DAOMBR144PYU1_G011940Similar to MJ1396: Uncharacterized protein MJ1396 (Methanocaldococcus jannaschii)
Pytul_DAOMBR144PYU1_G011939Protein of unknown function

Sequence
2860 bases(100 bases per row)
CAAGTCGCGTTGCAGAAGGAGAACGCGCACAGCGGCACGAAGAGTGTCAAGATCACGTACTTGGGCGAGAAGGAAACGTTTGTGACGGTCGGTTTCACGC
GTCAAAGCCAGCGTCAATTCAAGGTCTGGGACCCTCGTAAGCTCGACAAGGAATTGAAGAAGGTCGACATTGACCAAGCCGCCGGTGTGATCATGCCGTT
CTATGACCCGGACACGAGCTTGCTTTACTTGTGCGGTAAGGGTGATGGTAACATTCGATACTACGAAATGTCGGAGGGCGAGCCGTACGCGTTCCCGATC
AGCGAATACCGTTCGACGACGGCGGCCCGTGGTATGGCCATGATCCCAAAGCGTGGCAACGACATCATGGCGTGCGAAACCGCGCGTTTGCTCAAGTTGA
CGTCGAACGCCGTGGAGCCATTGCACGTGTACGTTCCTCGTAAATCCGATGCGTTCCAGGACGATTTGTACCCGGACACGTTCGCCGGTGTGCCTTCGAT
GAGCGCCGACGACTGGTTGGCCGGTGCGGACAACTCGCCTGCGTTGATGTCGCTGCGTCCTGAAGACAACGGCAAGATCACGTTCGATGGCAAGCGCGCG
CGCAACCAGACGCGTACGACCCGCGTGACGCGTCCACCAGCTTCGGCGCCAGGCGGCACCAAGGCCTCGGCGGACAGCTCGTCGGAGAGCAAGTTGCAGC
GTGAGCTCGACGCTGCGAACGCACGAATCGCCGAATTGGAAGCCAAACTTCGTGCGAACGGCATCTCGTATTAAAAAAATCGATCCTCATGGCCGAGAAG
AAGCGATAGCTGAGCTGGCGATTAAGAAGAATTGAGAGCCACGAACCGAAACGAACGAACAAACGAAAGGAACTAACAAGAATGGGGACACGCCACTTTA
GAAAACGCTTTTTTGGTTGTTGACTTTTCTTTTGAAGAAAAAAGAGAAGGTATGGATTTTAATTCGTGCGCGTTTTCCCCCATTTTGCATAACAAATCTG
CTTTTTGTTTATGGCCCATGCGTTCTCTATTTCACGTATTGCTTGCGCCTCAACTCTAACTTTGCCTAATGACGTGGAAGCATGGAGTATGCTACAGCCT
TGGAGTGTGACTTTGAACATTTGTGCAGACGCTAACCTTGGGTTCAAACAGGCATTGGCTCGGTGAAGACAACGTTGCGGCGCAGCGATTCGAAGCTCCA
GGACAAGATATCGTGAGTCTGCCACGCCGTTTCCCCCGTCGAGGCCGTGAAGCCCACCCACGCGCGCCCGTGTTCGAGCTCGATGGTGTCGTCAATCCGC
AGCGGCACACTCATAATCGGCGTCTCCATGTTGCCGACAAACACCGAGAGCACGCCGACGCCGGACGCCCAGCCGCCAGATGCGAAAAAGTGACCCGCGT
ACGTGGCTGCAACGAAATGGTCGGCGAAAAGCCTGAAGAGATAAAGGAAAAAATCACAAGTCAAGTCACCAGGTAAGCCTACCCGACAAGGGCGCTTTTA
CGAAGACGCGAAAGGAATAAACGTACATGCTGTCGTCGTCCAGGATGGGGTCATAGCGGATCTTGATAAGGTGTTGGCCGTCGGTCAAGTCCAGAATGTT
GCTCGTAGCTCCGAGGGCGTACGTATGGTTGGCGCGTACCTCGTTCACCTCGCTTTTACCACTCGCGTGGACGCTAACGTGGTTCTCGTAGACGTCGAGT
TGCTCATAGTTGAACCAGGTATCGAATTCGACCGCGAGCGCATTGCGCAGTCCGCCGTACCCGAGCTCCATGCCGCCATCTCCGATCGCGAGTTCGTGGT
CGTTTTGCACAACGAACGCAAAGCCGTCGCCGCCTCTGGAACGACAATTCGTGTACACGTCGTCCATATTTTTACAAAACGTCGACGGATTCGAGATGCG
TAACGTGAAAGTCGTCTCAAAGCCTTCGCGCACATTCATTTGTCGCGGGTACCATGCAGACCCCGTTAGGAAGGAATGCGACGACGTCAGACGCAGCGCA
GGTCCACAGCCACCAGTGACCGGTGCAATGGCAGACGCACCGTTCGGGAGTGACGAACTGGAGTTTCGGATCGTCTTAGCCGGGAATGGGATCGCATGGA
GTGCGTTGGTCGACGGCGAGCGATCTGTTTTGCGATTGGTATACGTCGACGCGCGGGTCTCGGTCTCCGAACACACGTATGTGCATGAAGCCGTCTCGGA
ACCAACGGCAGCGGCATTGTAGCCGTCACAGCACGTAATTGAGGCATTGCAGTTTTGAATCTAGAGCCTCTCGGAATCACACACAAGATTCAGCTATAAC
GCTATAGCCATTCACAACAAGCATGACGATTCACCAATTTCCGTACATTGGTGTGGCCATTGACGTAGAGGCCGAAATGGCCTTGGTTGCCAATCTCGCC
CGTCGGCCCAAGTGTGGGCTTCGTAAGTGGAATCACCATCAATGCGCTCACATTCGTAAGCAGCCGCGCTTCAAACCTAGGAAATGTGAAATCTACATGG
AGCAGTACGACACACATTAGAGCCTGACTTTGGTTTTGTCGACGCCATTGTTGGACACTTTACCGACTGCGAGTGTCGTTTTGCACGTAGAAGACGGAGA
TTCGAGTCCCAGAACAGCATTCTCCAGCATTGCACGTCGTCCATAGAGATCCAAATCCTGCCACTGCTGCCAGTCGCGGTAATCTTCGGTCAAGGCCGTC
ACTTGGACCTGGTAGCTCGTGTTGCGCTCGAGTACGATCAGCGTCGTGGACGTGACATTGCCCAAGATCACCGCATTTGCTTCTGAGTAGCCAGCATCTG
TGCATTTCTTCCAGCGCACGCGATATCCGGTAACAGTCATGGCTTCCCAGATATCGCTTG