Description :
From Genome Similarity Track
Location :
Scaffold_11:384956- 386392
Transcript NameFunction/comments
Phyra_75154tubulinspecific chaperone B putative
Phyra_94055Hypothetical protein
Phyra_39678ribosomal protein

Sequence
1436 bases(100 bases per row)
GCGTGATAAGCAGACACACGACGCCCTCGGGCACGTTGTCGTACTGCTGCCCGTCCATGGCCATCACGTAGTTGCGGAGAGCGCGCATATCTTGCGCCAT
CCTGCCAATTGGCGTCGGGTCGGCGAATGCCGTCGACAAAGACTCACTATGGTGTGACTTAAGTGCGATTGGCATTCCTCCTTTTGATCAATGATGGTGG
AGCTGCCAAGCATCACGGCGCTCAAGGTGTACGACGTGCTGCTGATCGCCGTGGTCGTGCTGGCTGTGGACCTGGCCATGAAGCTGTGGAACGGCCGCGG
CGCGCAACTGTCGCCGGCCGAGCAGAAGCTCCTGGTTGAGTACAACGAGCAGGTGCGGCTCGTGAACCGCCTCAATTCGGTCGAGACGTTCGTGGAGCAG
GCCAAGGCCACGCGCCAGATGAACTCGCTCAAGAAGGAGATGCAGGAGCTCGCAGGTGCGTTAGATGAAGTGGTTTGTACTGTTGTAGTGTTGCTCATGG
CGTTGGATCTGGAATGTGGGTCATTGTGCCTCTGCAGTGGAGCGGCTGGCTGCAAGCGCGCCTTCGGAGCTCCAGAAGCAGTTCGACCGTATCCGAACAG
TGAGTTTGCTGACAAAGATTCATGGCTTGAATGACCTTCACTGAACTGCTTTGCTGTGCCAATGTATTGCTACGACTGCATCAGCCGGTGATCATGGGTT
TAGCTATGCTGTACTACTGGGACGAGCCGCTGGTCGTGCTGCCGCAGGGCTACATGATGCCGGTAGAGCGACTCATGTCGTTCCCAGGTTTCCCGCTTGG
CGCTGTCTCGGCGATGGGCTGGGTTGGAATTTGTCGCCGTGTGAGCGCCAAACTTCTGGGCTAGACGACCTGCTTGACCTGAAACGACGGCAATTACCTG
GTAGACAGCGCAACTAGCATAATCCTCTATAACCTGTTCAAGCAATCAAACCACCCTGCAACCTGCGACGAGCACTTCACAAAACGAGCTGAAGAAGAAA
TCCAAAATGCTGTGTGCCACGTGCATGGTTGGCATGCGAGTTCGATTAAGCTGAAGTTACTACCCGACCCGACGCGTTGAGAGCGGCAGGTCGCGTGGCG
TATGGCAACTTGAGGCGTAACGACGTCTAGTAGTCCTCGTCTCCGCCGAACATGTCCATGCCGCCGCCCATGTCGACCTCTTCCTCCTCCTCGACGGCCT
TCTCCTCCACCTTGGCAGGAGCGGCACCGCCAGCAGCGGCACCGGCAGCGGGGGCAGCGCCCACCGAGACCGTTGCGATCTTGGCCTTGCCAGCCGCGAC
CACCTCCTCGATGTTCTTGCCCTCGAGCTCCTTGACGAGCTTCTCGGCCTGCTCCTGGTCGAACTCGCCACCGAACGAAGTCACGACCTTCTCGAGGTCA
GCCACGGCAGGGCTGGCGTTTCCGCCGAGAACACAC