Description :
From Genome Similarity Track
Location :
contig_9:384752- 387508
Transcript NameFunction/comments
g2255.t1hypothetical protein

Sequence
2756 bases(100 bases per row)
GCTTGCTCATGCGTTTGCCTTCAACGCTGCAATTGCGCCTAGAATCTCTGTTGTCAGCTGGTGGTTGGCCATCCACATCGATTCACTGTCTCGCTTGTGG
CGCTTTGACACTGCGTCCGAGTTGGGCGCCTTCAGTGGCAGAGCTGGAAAACGCTCAAGCGCCTCGTTCTTGACGTAGTCCCAAACCGCACCTTCGCCGT
TGACCTGCTGGAGTGCAAACAAGACCACGACGGGGCCTCGGTACCACCACCCAGGGTGCCGCGGCTTCTGCGTGTCCAGCATGACAAAGAACTCAGCACC
GAGCTCCTCGTAAGCAGATATGATAACCGACTCGAACGCGTTCTTCGCCGTGAGCTGACGGTTGCTGCGCTTGTTGCAAGCGAGCAGGCTCGTCTTGCGT
GACATGGGAGCCCAGAAGTTGCGCTCCCACACAGCACGAGCGTGGTTGCGCCAAAACTTACGAAATCTTCGTGAAAGTTCAGGGTGCTTGGGCTCATCAA
ATGGTGCTGGCAAGTTGGAATACACCGCTTCCCAGGGGATCTGCGCCTCAAAAGGCCCCATTTTCCGAGTTAACTCCAGCTGACTGCGGCAAATGTCACC
ACTCATTGCCGGCTTACCTCTTCTGTGAGACTTCTCTTTAGCTCGCGCGGCTCTATCAGCCTTACGCTTTCGTCCTCTATTGGCCTTGGGGGCCTCCAGC
GATTCAGCCAGAGAAGCTTCAACCGGTTCTGCAGTTGTAGCAACACCAGAACCCTTTGATTCATCACTTGCAGCTCTTTCTTGCAGCTTCCTGCCACGTT
TTGGAGTTGACACAGCGGCGACTTCAGTTTCACTGTCGGGCGCATTCACAGGGATCCGCTTGCGTCGCCTCTTGGTGACAATCTCAGGCTCTTCCACAGG
AGCATCGTCAGGACCCTCCACAGCTGCAGCATCTTCCTCCAACACCGAAGCCGAGTCATCTTCAGGCTCTCTAAGAGCTACCACATCTTGCCGTTGCGCT
GAATCATCAGCAACAACCGCTGTAGTCTCTCTCGTCGCCGAAACACGACGAAGTCTCTTCTTTTGAGGCATCTGCACCTCGTCAGCTCGTGCTACAGCAC
GAGTGACCGCTCTTGGCGACGCTGCCGTCCTCCCTCTCCTCTTCTCCCCCTTCTGCTCGACAGCCACGTCCGTCGCCACTTGCTGCTCTGGAGGCGGTGC
CTGATACACAGGAGATACCAGTTGGGGCAGCTCGAACGGAATCACACTGATCACTTGACATCCTCGCTGCACGAAGTCCATGAGCGCCGTATCTCGCTGG
TACACGAACTGCAGGAACATGTGCTTGAGCAACGCCATGTTCCTCGTGGCCGTGCGGTACTGCAGGTAGAGGAAGACGCAGCCGCGGGAGTCGAGGGTCC
ATTTCGGCTTGGACAGCAGGAATTTCGCTTGCTGCCGTCTCTGGGCGCTGGTTCGAAGCACCGGGAAGACGGTGATGATGGTACAGCCTTGCTGCATCAT
TGGCACCAAGGTGTTCTCCTGCTCATTGAGGAAATCGGCGAAAATGCGACGCAGCATCCACAAGTTCTGCGACTTGAGACGCAGCTCCAGGTAGACCGCA
AAGTCCTGCAGCATTGCGTGGTCTCGAGGCACCGACGGGGGAGGAGCTCGGCCACGACTCACATACCCGTCAAACGTCACTACAGAGCGCGCACGCGTTG
TGTGTCCCGAGGAATCGACGGTCGTCGCCATCGTGTCGATCTCGTGGATAGTGATGAATGACGAACAGGAGTCTGAGCCAACGGCGTTTGACTAACCGAA
ATGCTATGTGGGACTAGGACTGACGCAGCAGTTGACCCGATTCTTGCTGTCCGAACCAGCCGAGCCACGTCTGGAAGGTTTTTGCTGTCAGTTTGGTCTG
ATGGAACTCTTTGGCCGTAGCGTATTTGCCTTCAGAGGCGAGGATTTCGACTGCTCTGGAGCGAGCCCATGATGCAGCAGAGTTGGCAATGCGTTGCTGG
GCTCGACGACAGCGCAGTCGCAGCTTGGCACGATGGGTGGCGACTCGTCGCCACTGACGAAAAGCTCGAGTTTTAAGGCAGCGAGTGGCCAAGTGGACAG
TAGCAGTGAGCTGACTCGGACCTCCACTGTACAGACAGCGATAGAGGTAAAAGCGGGTGTACGCCTGCAAGACGCTCGCCTTCATAGCTTGATGGGCCAG
CAGAGCCGCTCGACCGAGTACCTTCGGACTAATCGGTGGGTTCTTTGGACTCCGAAGCAGCTTCACCGAAGTCTGGCGAGCCACACGGAGCTTGATGATT
GGCTTTCTTGCTCGCAGTCGAACGCGACAACACCCCCTCTCCTTGGACTGTTGCTGGTGTATTAACCCGTGCACTTGTCCGTCCAGCAGCTCCGACGTCA
GCTTTTCGAGCGCAATCGACTCGCGCTGATACTCTCGTCTCGTCGACGTACTCAGTAGCAAAACGTCGCTATTAATCACTCGCAATTGCCCATCGAAGTC
TGAGCAAAAGGAGGCGATCAACGCAGTGTATCTACGAGCACAGGCGTCCGATCCAACACGCGCGACTGATTCCAGTTGATCCTGAGCTCCCCCGAGGTCG
TTCGAGCTCGAAATTTCACGCCGTCGATTCGCGTTTGAGCCAGCAATTGTTCCTCTTCCACTCCGCTTTGCAACACTTTTCCTTTGCAAGAAAATCTTCT
TGGCGCGGGCTAGCGCCGGGAACGCCGCGATGTCCGCCATGATCACTGCTTCAACA