Description :
From Genome Similarity Track
Location :
scaffold_24:384567- 386543
Sequence
1976 bases(100 bases per row)
TTCGGTATTAGAAAGGATAAAGGTAAGTTGCGAATTGTGCGTGCTTAAAATAAGCTAGATGCATTCACAAATACGGTGTTTCGCATATACTGAGAAAGGA
TCAGCTGAAAAACAGTATGGTCGGCTGCGCTATGTTCAGTGCCTCAACCTTTTGGAAGTTCATCATCAACCGCTGATGAGGACCAGCGATCTCCTCTCGC
TGCGATGAGTATACCATGCGGGATGCTCTGTGAATAGCTGGTTATGCTGCCGAGACTGTTAAACTCACCACTAACATTCAATCGCCAGGTGATAGCTGTC
TGGCCACAGGCTGGCTACGCACAATTCTATTTTAACAGCATATTTGTGTATAATAGTGCAGAGCACGGAAAGTCAACTTTTTAACAGAGCATGTGCGAGC
GgtactcgagtgtatgcgctctAAAAAGCCAGTCACGATATGGACACGATATGGACAATTGCGTATTCGTCGACATCATCCCTATCGGGTCGCTCCATAC
AGAGTAAGAGTCTGCAGGCAATCTCACAAGGATGAAGACCATTGTAGAATGACCAGTGACTCTACCCTGAAGAAGCTTGatgaagtggcttggcctggtC
AACTACTTGGGCAAAATAGGACAAACTATGTCGAGATGGCATAATCTCTCGCAATTATTTATAATATTATGTGCTGTTGGGGTGCGGCAGAGTAGTCAGT
ATTTAAGGCTGCGACAGAAAACCTCATTCACTCTCAACGCTGGCTTTTCCGAGTCCAGAATGGACACCCCGCaactgtgacgcttcagtctTCGCAATAG
AGTGCGTTATACTCCAAATATTTTCCAATGAACATGAAGCGCGGTCGTACTTGAGTCTTGGCAGCTAAAATACTGCTGAGAAGTACTACCCTGCTTATGA
AGTTCATCACAACGTCTCATCGAAttcagggttcacctgcATGGCTCCAAGCCATTGAAGATCATTACAGAACATGTCATGCATCGTTTTCACCGCGACG
TCGTCATTGCGCATTTCACCTAAAACTCAAGATGGTTATTCTTTTTTGCTGAGTATATCATTCAGGTTAGGTATAAATCGGGTCGGCTTGATGTGTTGGC
TAATGCATTTTTGCCCCGACCCGTCCACATAAATTGTTGCATGACGGCGCGAATTGATAAGATACGTAAAGCGTACGGGTCAACTTAACATGTGTTGTGC
TGCTGAAAGCTGTAGAAGCACAAGTTGAGAGCCCAGATGTCATTTTTTATCAAAGCGCACGGTTGCAGTCATGCAGCACAATGTCTTGTCTCAAGGCTTG
TTGCACTACAGTATTGGTTAACATGAACTCAGCACGTAGTGGCGCTCCGCAAAAGAATATCATGTACAGAACTCTATTCGAAACACATGTGGGGGTCTAC
CTTGGAAGAGAAACGACATACTGCTTTGTGGGTGCTATGTGTTGGTGGCTCAGCATGGATAAGTGGGTAAGCACATATTTGCTCCTGGTGAAATGTGCTA
ACGGCTCAATCCCTACTTGAATGCGGCATATATGGCCAGCGTTTCTGTTTTGGCAGAGAGCTGGCAGGCCATGACTATGATCATATTTGACGATTATCTA
AAAGACGGGTAATGTCCGTTTTGTAGACtttgtcagccctctcagtaagatggctcatctcgctgctgacagcggcaaTAGAACACAGTCAAGCTATGCA
AATAATAATGTTTCGCCAGCACGGGTTGCCAGTTGTCATTGCGTCATCATATAATCCGCGCTTTGCAGCGAAGTTATGAGACATATTGTTCAAGGTGCGC
GGCGCCGGATTAAATATGTTAGCCGCTAACAAACAGATGGTCAGTCGAAATTATGATGATCACCAAAGCACTGGTGCGGAGTGGCCATGGTGGTGGAGGG
AGTTGCCCCCACTCATCAATTTGCTATAAATAATGTAGTGCATGCCTCTACAAGCTTCATACATTTTGCATAAACG