Description :
From Genome Similarity Track
Location :
Scaffold_2:384539- 387156
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G001040Similar to PAPD5: PAP-associated domain-containing protein 5 (Homo sapiens)
Pytul_DAOMBR144PYU1_G001039Similar to SG1048: UPF0176 protein SG1048 (Sodalis glossinidius (strain morsitans))
Pytul_DAOMBR144PYU1_G001038Similar to P5436: UPF0696 protein C11orf68 homolog (Danio rerio)

Sequence
2617 bases(100 bases per row)
TGGCTACGAGATTTTACACCACGACCCGAAGAAAACGGCCGAGATCCGCCGCCAGTACGAGACGCGTCGCGACGAAGAAACCCGCAAGAAGAAGGAAGAT
GCAGACGCCCAGCGCGCACGAAGGCAGCAGCTCCAGCCGCAGCGTCGCGGGGGTGAGTCGCCGCCTGCAAAGCGTTGGCGCGGCCGGACAAGTCGGCATT
ATTAGGCACACTACCTTGGACCCCAAAAATATATACCTGTTCATATCGTGATATAGTTTGCAGCACTGTTAAGTACGATACCGTTTGATACCGGTACTGG
TACCGTGCCATTTGGTCGGCCTGCGATGATAGGCATGAAAAAAAAAGCGAAGCACAAAGACATACAGCATCTGCCACTAGTGAGAATCGGCGGTTCGCAG
CAGCAGATAGAGTCCCGATGCTCCGTGTGCGCGCCGCAACCAGCGCATGTGCTACAGCCACTCACCAGTCGCGCTGCTGGGCCACGCGCGGCGGCGCGTC
ATCAACAGTAGAGCAGCGGAGCTCTTCGCGCTTGGCGCGATGGCTCAGCACAAGCAGTGGCGACGACGCAAAGACGCTGCGCCACCAGTACATCAGTCTG
TACCACTACACGCCGCTGGAGAAAGAGCAACTGCCGACGCTGCGCCGCGATCTGTTTAACAAGTGGATGCAGCTCCAGGTGCTCGGCCGCATTTACATTT
CGCAGGAAGGCATCAATGCGCAGTTGGTGCTGCCCGAGCCCAACATCGCGGCTTTGAAGACTTCGTTCCCGGCGCTGCTCACGAACGCCAAGATGTTCTA
CGGCCAACTGCTCACTGAGAACGATGAAAAACACTCAGTGGCAGCGCTGAAAGCACAGGACTTGTTTCAGAAGCTTGACATCCGCATCCGCGACCAGATC
GTGCGCGATGGCTTTGAGAAAGGCCACTTGGATCTCCAGGACTCGGGAAATGCGCTGCCTCCAAAGGAGTGGCACCAACGCCTACAAGAGCGCAATGCGA
ACCAGGACGACTCGACGCTCGTGCTGGACGTGCGCAACTTTTACGAGCACGAGATCGGTCGCTTTGACGGCGCGACGCGCATCATGGTTGACACGTTCCG
CGACACGTTCGACGCTGTGGACGAGATCCTCGCACGCCACGAAGCGCAGCACGACGGCGAGAAGCCCAAGGAAGTGATGATGTACTGCACAGGTGGCATC
CGCTGCGAGAAGGTCGGCGCGTATCTGGCGCAGTACAAAGGCATCACGAACGTGCACAAGCTCCACGGCGGTATCGTCAACTACATGCGCTTTCTCCAGG
AGAGCGAGAAGGAAGCAGAAGAAGATAAGAACAAGGCTGTGGAATCGCTGTTCAAGGGCAAAAACTTCGTGTTCGACCAGCGATGCATCACGAATGGTGT
CGACGCTGTGGACGTGACGCCCGATGTGCTGGGCGAGTGCTTCCAGTGTGGCGAACCGTGCAACCAGCACACCAACTGCCGCAACCTCATGTGCCACGGC
CTCATCCTGCAGTGTGCCAACTGCGCCGCTAGTTACCACGGCGCGTGCAGCGACGCGTGCAAGGAGGAGGTGCTGAAGATGGCGACGATGACGCTGGACG
AGCATCGCGTGTACAGGAAGCAGAATGCCGCGCTGTGGAAACCGAAGAACCCGAACGCGACGAGTCATAAGTACATCAAGTTTCGCCCCGTTTCGCCACG
GCTTCAAGCGGAGCAAGCGTAAGACTGTAGAACCGCATCAGGCACTCACATAGACAATCACACTCGATCCATTTAGACATTCCACCTCATCATAGACTTC
CATTGTCCAGTGGTTACATTACCTTAATGATTTCGACTGCTCCTTCGTCTAGTCACTCAGCTTCATACTCGTGCTCGCTGCTGCGCTCTTCTCAGGGGAA
ATTCCTGCGAACCGAGGTGGACTGGGCTCGTTTCCCTCCGCGATGGTTCTCACCCCAAACTCAACTGTCTACACTACTAAAGGGTCTGCGCATGGTAAAC
GCTCTCGCAACACCAGCGCAGCTCTGGAAGGCATCCCACCTCGCCCACATGATCTGGTAGGCGCTTAATCGGCATAGATGGATGCGTGGATCCCCCACTT
GTTGCCTTGGTAGATGTCCAAGTGCGTGTACGCGTCGGCTTTAAACATGAGGCGCTTCGTGGCGCCCATGCGGCGCAGCGTCTCACGCACGCGGAACACG
TCTTCGCGGTCAGTGTAATCGTTCACGTACACGCAGATGAGGTGCGTGCGCTGCGCGTCGGGGGACGTGGGCGACACTTTGGCGCTGACGCCGAGTGCTC
CAGACACGACGGCCTCGGCGACATGGCGCCACACATCGTCGACCTCTTGGCGGCGGCAGAAGAGCATCCACTTGCCCGAGAGCACCTGGAACCGCTGCGC
GAGCGCGTGGATGTGCGCGGCGCTCGACCGCAGATCCTTGCGGTCGCACAGGTCGCGCCACGCGCATTGGAGCCCATGCGGGTCGCTGCGACGCGTGATC
TGCTGCTGGCGCTCCACGTGGTGCGGGTGCGCGCTCTCGACGTAGATCCACTGCACGTGGCTCTGTGGCACACGTGAAGGCAAGTTTGCTGCCAGGAACT
CGTCCAGCGATACGTCA