Description :
From Genome Similarity Track
Location :
Scaffold_448:3845- 7840
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_448-fgenesh-gene-0.0ATP-binding Cassette (ABC) Superfamily

Sequence
3995 bases(100 bases per row)
GTCGAGAAGTGGTACTTCCCCGTCTCACCAAGCTACTGGCGCCGCAAGATCGCGTCCTCGCGCAAGGTCACGGATCTCACCAAGCTCGAGGAGACGGTGA
TCGAGATCCAGGACAATGTCGAGCCCGTGGGGCCTGAACTGCGCGCGCAGGAACGCAGCGGCGAGGCGCTCGTGATCAAGAACATCCAGAAGGAGTTCAA
AGTGCCCGGCGGCATCAAGAAGGCCGTGCGCGGCGTGAGTATGGCCATGTACAAGGACCAGATCACGTGTCTGCTGGGCCACAACGGCGCCGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCTTCTTTGCGCGCGTCAAGGGGT
ACACTGGCCACGAGCTCGAGGACGTTGTGACGACCAAGATCAAGGAGGTCGGGCTCACGGAGAAGCGGCGCGTGAACGCGGCGTCGCTGTCGGGCGGCAT
GAAGCGCAAGCTGTCGGTCGCGATCTGTCTCTTGGGCGACAGTGCGCTCGTGTTTCTGGACGAGCCGACGTCGGGCATGGACCCGTACTCGCGCCGAAGC
ACGTGGGAGATCTTGGTCAACAACCGCCAAAACCGCGTCATGGTGCTCACGACACACTTCATGGACGAGGCCGATATCCTGGGAGACCGCATCGCAATCA
TGGCCGAGGGCCAGCTGAAATGCTGCGGCTCGTCGCTCTTTCTCAAGCAACGGTACGGCGCCGGGTACAACTTGACGCTTGTGAAGCAGGCTGAGACCGA
CGGGCAGCAGCTGCAGGCGTTCGTGACGCAGCGCGTGCCGCGGGCGGCGGTGCTGAGCAACGTTGGCGCCGAGATGGCGTTCCAGCTGCCGCTCGACACG
TCGGCGTCGTTTCCGGCCCTGTTTGAAGAGCTGGACGCGAGCCTCGAATCGCTCGGCGTGCTGTCGTACGGCATCTCGGTCACGACCATGGAAGAAGTCT
TTATCAAAGTGGCCGAGGCCGGCGACGAACACGACCAGCACACGCTCAAGAAGGAGGCTGCTGCTCCCGTCCGGGAGCTAAGTGGCCCGAGCATCGCCCA
CCTCTCGGGGTTCGTCATGTTTGTGGTCCACCTCACTGCTCTCTTGGCCAAGCGATTCTGCGTGGCCAAGCGCGACCGGCGCGTGCTCCTATTCAGCGCG
CTGCTGCCCGTGCTGCTGCTCGCGACCGGACTTGCGCTGCTCAAGTCGAGTTCGCTCACGCAGGCGGATATCAAGCTGCGACTCACGTCCGAGTCGTTTA
TCGCGGGTACGAACATGCAGGTACCATACTATTGCGACGGCGCCGACGACGGCCAGTGGTGTGCCCACACCATGAACCATGTCTACACCAGTGGCAAGAC
GGCGCCGTTCGCTGCCGGGACCGACTTTGCCACGCCTCCGTACGCCACGGCGACGCCCACGGTCTTCGGCGTGACGTACTCCACGGAGGAGCTGGACGTT
GCTGGGACGAGCGGACTCTGCCTGCGGCTTGGTGAGAAGTCTTTCCAACGAGCGTTCGGCGTCAACACGACCCAGCCGCCCGTGAAGAACCAGTACGGCG
CGTACGTGCTCCACGCGTCCAGCAGCGAGCGCGTGTTTGCGTACCATTCGATGCTCAATACGACCGCGACCCACGGCGCTGTCATCTTCAAGGCACTGCT
GGACGAGGCACTCGTCCGGTTCATGGCCAGCGGCGCCGATGTGACGGCGTCCAGCGGTAGTCCAAAGGTCAACCTCACCGTGAACGCGTTCCCGCTGCCG
TACACGGCGACGACCAAGGCGCTGTTCAGCTCCTTCCTGTCCTTCACGGCCTGCATCTTCATTGTGATCGCCTTTGCCTTCTTCCCGGCGTCCATCGTGG
TCTTTCTCGTCAAGGAAAAGCAGCCGGAACACAACTCCAAGCACCAGCAGCTCGTCTCGGGCGTGAGTCTCCCAGCCTTTTGGCTCAGCAATTACATCTG
GGACATGGCCATGTACACTGTGCCCTGCGTCGCTGCGATCGTGCTCATCCAGATCTTTGACGTCTCGGCGCTCACGGGCAACGGCTGCACCGTGTGCACC
GACGCGACGTACCCAGCCGTCGTGCTGCTCTTCGTGCTCTTCGGCCTCGCGATCTGTCCCTTCACGTACGTGCTGTCGTACTGCTTCCGCGACCACGCCA
ACTCGCAGACGTACACCATCATGATCAACTTCATCCTGGGCATTGTGCTCATGGTCACGTCGTTCATCCTCGACCTCATTGAGAGCAGCAAGGACGCCAA
CAAAGTGCTCAAGTTCTTCTGGCGCCTCTCGCCGCTCTACTCTCTCGGCACGGGGCTGCTGAACCAGGCCATGGCCGAGATCCTGTTCAACGTTGGCTTC
CAAAAGGCCAAGCCCAGTCCGTTTGACCTGGACATCATGGGCTGGGAGATGCTCTACCTGGCCATTGATGCCGTGCTCTTCTTCACGGTCGCCGTCGGCA
TCGACTTTGTGCTGAGCTTTCCCAAGATCCGCGCGGCCGTGTTCAAGGACCCGGTCATCCAGGACCCGCCCCACGAGGAAGATGACGATGTGGCCAAGGA
AGTCGCGCGCGTGCGCAGCGGCGCGGCCGCCGGCGACGCCGTGCTGGTCCGCAACCTGCGCAAGGTGTACAAGGGCAACAAGATCGCAGTGCGCGACCTG
TCGTTCGGGCTGCCCAAGGGCGAGTGCTTTGGATACTTGGGCATCAACGGCGCCGGCAAGACGACGACCATGAAGATGCTCACGGGCGATATCCTGCCGA
CCTCTGGCGGTGGCTCGCTCGGCGGCTTTGATATCCTGAGCCAGCAGCTCGACGTGCGCCGCCAGATCGGGTACTGCCCGCAGTTTGACGCGCNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTGCGCGCATCAAGGGCATCCCTCGTGCTCGGCTCGACGCGGAAGTCCGCGGG
CTCATGCACCAAATGAACCTCGACGACTTTGAGCACAAGCTCGCGGGCACGCTGAGCGGCGGCAACAAGCGCAAGCTCAGCGTCGCGATCGCGATGATCG
GGTCGCCGCCCATCATCTTTTTGGACGAGCCGTCGACCGGCATGGACCCGGTCTCGAGACGCTTCATGTGGAACGTGATCGCCGAGATCTCGACCCAGAA
GAAAGAGTCGACCATCATCCTCACGACCCACAGCATGGAAGAGTGCGAGGCGTTGTGCACGCGCGTGGGCATCATGGTCGGCGGCCGCCTGCGCTGCCTC
GGCAGCGTCCAGCACCTCAAGCATCGCCACGGTGACGGGCTCATGGTCGAGCTCAAGCTCGAGCCGGCGACCACCGAGCAGATCGAGGCCCGCGTGGCGT
CGGTCTTTGNNNNNNNNNNNNNNNNNNNNNNGTCTTTGGTTCCGCGTCTTCTCTAGAGGACACCCTCACCAAAGACGCCCTGACCGAGGCCTGCACCCGC
ATGGGCGACGCCTCGTGGCTCAGCAAGATCGACGACAAGCACGCCACGGGCTACGCACTGGCCGCGGCACTGACACGCGATGGCGCCGTAAAGAAGGCCG
TGCTGTGCGCGTGGTGGCTCGCCGAAGAGCGGTACCTCGGGCTCCACGCATTCCTCGAGCAGAGCTTTGGCGTCGGCAAGGCCACGCTGCTCGAGCGCCA
GAACGAGCTCGTGCGGTACAAGCTCACGGGCGAGGCCAAGACGACGCTCAAGCTGGCCAACGTGTTTCGCCTCGTCGAGGCCGGCAAGACGCAGCACCAC
GTGCGCGAGTACTCGGTCTCGCAGACCACGCTCGAGCAAATCTTCAACTTCTTCGCGTCGCAGCAGGCCGAAGAAAAGGGCGTCGCGCGCGGCAT