Description :
From Genome Similarity Track
Location :
Scaffold_1:3845- 5453
Transcript NameFunction/comments
g1.t1hypothetical protein

Sequence
1608 bases(100 bases per row)
GTCCTCCTCTGCCTCGTGCGATTGCATCACTCCGAAGCGATTCCGTCTAGTACGCTCGCGCTCAAACTCGTGCATCAAAGCCCCGCAGTTGAGGTCAGCC
TCGTCGACCCAAGACGGTTCGGTGTATCCCTTCCAGAAGACCTGGAATTCCCGATGGACGCGTCCATATCTGGTCTTACGACCCGATCGGACATCTGTGA
TCCGCTCCACTTCAAACTCGTCATCACTCCGATCACCTTCCCAGCTGTCCTCCGGCAACAACGCCTCATCAAAATCAAATCGACCATTCTCGTCCGTTGC
TAGCGTCACGTCAGGGCGATCAGAGAAAACCTTCACGGCCTTGAGCTTCGAGACGTGTACAATTGGAAAAAGACGATACTCGGTGCCGGCCACCTCTAGC
CGGGCCGCGTAGGGGCCAATCATCTCGCGCACCTGGAACGGTCCGTGCCACATGTGTGCCAGCTTTCGGGCATAGCCCTCCTTAACTCGATCCAAATATA
GCCACACTTGTGACCCGGCCTCAATCTGGTGCGGCCTTATCCCGTCGTTGTGGCGATCGGCTCTCGTTTGGATCGCCTCCTTCAGGCGCGCGTTGACCTC
CTCGCGAGCTCGTTGGTACTGTTGCTGGATACGATATCTCCATCTGCGCGGCTCGCGATCGCGACGTCGCGTGCTGCCTAACGGTAGCGACGCTTCCAAG
TCGATCGTGGGTCCCAACCATGGACAAGGTAAAACGGCGTCTCTCCTCGTACTCGATCGTGAGCAGTGTTGATCGCGAAAGTCAGGCGTTCCGCGTATTC
GTCCCAGTCTTGTTGATTCACATCGGCGACATACATCTTCAAAGCGCGAGTAAGCGTTTGCACCATCCGCTCAGCGGTACCGTTTGCTTGTGGTCGATAG
GCCATGGTGGCTCGTTGTCGTTGTCCCACTATACGGCTGAATGCGCGGAAGAAATCAGACATAAACCGGGCTCCCGATCATGTCGGATCGCTTCACTGGC
TCCGAAGCGGCGGAAAACGCATTCCTCGTAGTTCTCCGCGATGGTCTGCGCTGTCCGAGACGCGCCGGCCTTAGCGATCACGTACCCTGAGAACAGATCG
ACCCACACGAGAAGCTCCGTGTTGCCCTTGAACGACTTTGGCAGAGATGGGATGTGGTCCATCGCGATGATTTGGAAGGGGTAGGTGGCCCGTACATTCC
CAGGTGATTCTCCTTGAACCACGGGGCGCCCCTTCCCTGTCTCGCAATCCACGCATTCACCCACAAACTGCTGGACACTCTTGAACAGCCCCCGCCAGTG
GAAGTGCGCTTTGATCCGTTGGTACGTCCTCCCAATTCCCTGGTGCCCTCCTTCAAGGCTGGCGTGATAATGGTGAAGGAAATCTTGGTGTAACGTTGCA
GGTACCACCAGACGCGCGATCGAATCTCGGTCCTCGTCTAATCGGGTGGTGTTCACACAGTAGAACAGCAGGCCGTCTTCCCCTACTTCGTAATCTCCAG
CGATCTTGGCGCACGCTTTTGCATCTCTGGTAGTCAAGGCTGCTACGTCGCCCCGTAGGTACGACTTCAGGTCCACGATCCACTTCTCTTCATCCTGAGC
TTGTACTA