Description :
From Genome Similarity Track
Location :
contig_3:384451- 386041
Transcript NameFunction/comments
g919.t1hypothetical protein

Sequence
1590 bases(100 bases per row)
TCATTTCCACTTTCGCCGCCTCCGCCGCAGGTCTCCACTCCACCTTCGTCACCTGCCTCGGATCCGGACTTCGCTCACCATGTCGAAAGGCCCGTTCCTC
ACCGGTGAGGACTGCAAGTCGGCCTTCAACCTCTTCTGCTGCATCTACGGCATTGGTACGCTTGGTATGCCGGGCAACTTCGCTCGTGCCGGTCCGGTCA
TCGCCATCATCGCCATGGCCTTCATGGCCTTCGCCAACATCTACTCGTCCATCACCATGTCCAAGGTGATCCTGCTGGCCCCCAAGTCCGTCAAGACGTT
CGGCGACCTCGGGGAGTGGAGCATGGGCCAGACCGGCCGCTGGCTGTGCGTCGTCTCGCAGATGGGCTCCTGTCTGCTGATCCCGTGCGTGTTCCTCGTG
CTCGGCGGTTCACTGCTTGACGGCCTCTTCCCGAAGCCTTCAGCACCACAACCTGGACCATCCTCATGGCCCTCATGGTCATGCCGGTGTGTCTTGTCCC
CACGCTCAAGGAAGGTTCGGGCGCCGCGTTCGCCGGCTGCATGGGCACTATCATCGCCGACATCATCGGTGTCGCCGTAGTCATCCACGGCATGCGCGGC
CACCCGAGCGTGCCGTTCCCGGAGCTCAAGTTCCAGCAGGTGGCGGGTGTGTTCGGCAACCTGTCGCTCGCCTACGGAGCCGGCATCGTCATCCCGGACC
TGCAGCGCCAACACAGCGACCCCACCCGCATGCCGCGTGTGGTCGGAGTGACCGTCGCCTTTGTGTCGTGTCTCTTCCTGGTGCTCTCCAGCACGTCGTA
CTCGGCCGTGGGGTGCCAGATCTCGGGCAACCTGCTCTTCACCATCTACCCCGACCACGACACGGGCCTCACTTCGCTCGGCTTCGCGCCCGACTGGGGC
GTCGTCGTGCTGGCCTACCTGTTCATGCAGTTGCACATTACCATTGCCTTCTCGGTCATCCTGAACCCGGCCTTCTACATCTCCGAGCGTCTCTTCCTGG
GCATGCACAAGAGGGCACCCGAGGATATTGAGAACGGCTTCGCCTTCGAGGAGTCTGCCACCCCCGGTGACGGGCTCGCGAAGCAGTCGGATGCCGGCAT
CTCCAACAACAACTCGGTCCTCCAGTCGGCGCGCCGCTCCAAGATGTCGTACGTGTCCGTGGCCGACTCGGAGCGAGTGCACAAGGACAACGAGGAGGAG
GAGGCGGCCGAGTACACTGGCGGCAACGCCATCAAGTACGTCCTGCTGCGTATCGCGATCGTCATCGTACTGGTGGTTCTGGCCATCGTCTTCAAGGACC
ACTTCTCCGAGTTCGCCGACTTCGTGGGCGCCTCGTGCATCACGACCAACTGCATCCTACTGCCCATCGTCTTCTACCTCATCAAGGCCTGGGAGCGCGT
CCCCGCGTACGAGAAGGTCGCGGCCATCGTGGTGGTCGTCGTGTGCTTCGTCCTCGGCTGCTACGTCACGTACACCACCGGAAAGCAGCTCTTCTTCCCC
ACGGAGAACGACGCGGAGTTCCCGTACTGCGATTCCGAGTTCGAGAACACCATCTACTACAACTACACGGCTGAGCATGAGGCATAAGCT