Description :
From Genome Similarity Track
Location :
Scaffold_66:384413- 385780
Sequence
1367 bases(100 bases per row)
CGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCTAGAGAGGGCGTCCGCAAGCACGTTGAGCTTGCCCGGCTTGTACTCGACGCGGAAG
TTATATTCCGCGAAGAAGGACAGCCACCTCGCCATCCGTTGGGAGAGGTGAGGCGAGTTAGTCGCCTTCCTCAAGGATGCGTGGTCTGTGTAGATCACAA
AGGGCGTAGAGCCCAGAAGGTGAACACGGAACTTCACAAGGGCATATTTCATTGCCAGGAGCTCCTTGTCATGGACAGGGTAGTTCCGCTCGGCGGCTTT
GAGCTGCCTGGACTGGAATGAGATGACTCGTTCCTGTCCAGCCGTGTCGTCCTGCAGCAATGCACACCCGATGGCGTAATCGGAGGCATCGCAGACGACG
CTAAACGGCTTCGTCTCGTCCGGCAGAGCCAGGACAGGGGCCTCTTGGAGACTGGCCTTGATGCTGTCAAAAGCATCCTGGTGCTCTTGCTCCCAGCGCC
AGTCGACGTCCTTCTGAAGGAGGCTCGACAAAGGCTTAGCGAAGCCCGCGTACCCAGCGCTGTACTTGTGAAGGTAGTTGGCCAAACCCAACCACTTTCG
AAGATCCTTCTGGGATCGGGGCGTCGGCCATGCTGCTATGGCCTTGACCTTGTCTGGGTCAGCCCGAACGCCCACGTTGCTTACGAAGCAACCGAGAACT
TTGATCTCTGGTGACGCGAAAACGCACTTGTCGATGTTGGCGTAGAGCTTGTTCGCTCGCATCACGTCCAACACTCGACGGAGGTGTCCTAGATGCACCT
CCATGGCCGTCTTGCCTCCCTCGGCACGGCTATGGACGAAAATGTCGTCGAAGTACGTCTGTACGAAGGTACGCAAAGGGCGGAACAATTGCGTCACCAG
GCGATTGAACGTCGCCGGGGCGTTAGACAAGCCCTGCGGCATGACGAGCCACTCCCAAAGCATGCCGCTTGGAGTGCTTACCGCGGTGAGCGGGATGTCG
CTCTCTCGCATCAGGATTTGGTAGTATCCGTCTACCAAATCCAGCGCACTGTACAGTACGCTCCCGGCCATGTTGTTCAACAACACATCCTTTCGTGGGA
TCGGTGTTTGGGCCGGCACCGTTGCGTTGTTCAGCTTGTTATAAGCGTGAACCAGACGCCACTTTCCGTTCGGCTTGCGAACGCAGAAAGTCGGCGTCGA
GTGCGGGGATTTCGACTCTCGCACCATGCCTGCCTTCGCTTTCGCGGCGAAGAAGGCATCAATGACCTCGCACTGTTCGCGCGGGAGAGGCCATTGCCTC
GTGACACAATACTTTGTGCCGGGCACGAGATCAATCTCGTGCCGTACGCCTCGATCCGGTGGGAGTT