Description :
From Genome Similarity Track
Location :
Scaffold_11:384411- 387910
Sequence
3499 bases(100 bases per row)
ACTTGTACGCTTCCTCATCACTACGTGTAAGTAAGTAACGGACACCCCAGGCCCGTTACACCTGGTAGCACTTAGTAGTCCTTCCCATGACCAAGTTCAC
GATGAGCCAAGGTATGACGTCTGAAACGCCAGTGCTGACCCTGGAACATGCTGCTTTCCCTCATCTCAATCGTGTCAAGTGGGAAGCCCTTCACCGCCCC
GCGGTGGTGTCTGGTGAGGCTGTAATCGCGTCGCTGCTGAGCTCAGCGACGTCCGACCAACAACGCCAAGCAGCCCAAGAGTTCATGGAACGCGAGCTAG
CCGATGCGAATCGGCGAGCAACAACTTCCGCGCGTTCCTCGAAAAATGAAGTCCTGAAGCTGGGGACGTCTACCTACTCCGGTGGAGGAGCGAATCGCCT
CCCACTGAACCGGTGGTTTCGCAAGATCGACATCGCGATTGCTTCGAGAATGATCGAAGCGCAAGGGGCATAGGTCAATTTCTTATTGTCCCGGTTGTCC
GGGAAGGCCAAGGAATGGGCCCTCCGTAAACTTGTCGTTGATCACGACGCATTCCCCACTCTGGAGTCTCTCCAGAAAGATCTCAGGCTCGCGTTCGAGC
CACCTCAAGACGAATCCCGCGTGCGTGCCGAGTTCTTCGCCATTCGTCAAGGTAAAATGACGATGCGCGACTACGTTCAAAAGACTCGCCACCTCGCGTC
ATGCATCGTGACAAATCCGATTGACACAGCATCGCAGGTCCATGTATTCGTATTCGGCATGCGTGAAGGCATGACACGGTACTGCCTGACCCGAGCGGAA
CCTTCCTCTCTCGAGGAAGCATTCGCCCTCGCATTACGCGAAGACTACGTTGTGGCGGCGTCTTACGCGCGCGCGATGTCTACGGCAGCTCGTGAGTCAG
CCCCCGAGCCCATGGAGATCGACGCGATTGACGCGTCGAATATTCACCGTCAGTCGACTTCTCGTGGGCCCAACGGCCGTCCTAATCGCCCGCTCACTTG
CTTCCGCTGCCGAAAGATCGGTCATCGCGCGGCGGAATGCCGCGCGCCAGCGCCGGTACTCGCGCACACCGCCGAAGTCTCAACTGCCGTTCAGTCAAAA
AACGGTCAGGGCCAGTAGGTGCGGGGCGCCCTACTGCCTGGAATGGAGGTCCGGGTCCCCCGGTGGCTACCCAACCTTCTAGCCCTCCTGTGCTCCACGA
ACACTTTAATGCCACCACCACGTCGGGCGACTCGAGGCTGATCATCGTCAGTCTTCATGTCGCCGACGCCCGGCGACTACTTCGCGCACTCCTGGACTCA
GGAGCGTCGAATAACTTCTTTCCCGAATAGTGCTTATCGATGCTTCCAAGAGAGATTGCAGACCGTAATAGTCGAGGTCAGGTCGTCGTCAGACTTGCTG
ACGGAAAGCCACGCCGCGTTGCGCAGCGCGAGATCACGTTGCCGTACACATTCAACGGCTTCCGCAGCAACGACGACTTCCTCGTGATTGAGATGAACTA
CGCGTTCGACTGCATCTTGTGTATCCCGTGGTTGTCACGATATCAACCAGAGATTGACTGGTTGGCTCGGTCGGTTAAACACCGCTCTGGCTTCGATGTG
AGTGAGGTGTTCACGCACCTCCTGGTTGCCCAGAAGGACTGGCCCAATGTCACGGTCGTGGACCGGTTGTCCACAATGCAGGTTGAGCAGAGAGCGAGCG
ATCGCCCTCTCTGTATGTCTTGCACAGCGCTGTTGCGCGAAAACACCTCGCTGCAAAGCGAGGTTGTTAACACTTTGGCGGTAGAGCAGGGGCTCCCGCA
ATCCGAGCAGGCGGTCGAGCATGGGTTCCCGCAACACACCAAGGCGGTTGAGCATGGGTTCCCGCTACACACTCTAGCGGGTGAGCAGAGGTTTTCGCAA
CGCGATTCGGCGGTCGAGCAGTTGGAGCTCCCGTCATCATCACCGGTGGTCGAGCAGTTGACACTCCCACCGGCTACGACGGCGATCGAGCAGGGACTCT
CGCCAGTCGATGGCGCGGTCGAGCATCGAGAGCTCTCGCGCACTACCGACACGGTTGATGATGCCCCTCCGTGTGTAGAGGGGGGTGATCCCTCGTCCAG
CGATAGCGAGTCTTCAGTCTCGAGCAGCGTCTCGAGACGCCACAAGAAATAATCCAAGCGACGCCGTCTTAAGCGACGTGGTCAGCCCACCGCCGATATC
GCAGTCACTGAGTCCATACACGTCCTGGAACATGTGGAAGGAGGCGCCGCTAGCTCACACACACTTGACATTGAGATCCCACATCACGGAGCTTCTTCCA
TCACACGCCTTCCGGGTCTTTTCTGGAAGCATTTTCTGCGCGATCTGAACTCAGGAGACATCGAGCAGGTCTGCTTGATCACCGAGCCTGCCTCGGCGGA
AGAGATCCACACGGTCGCTACCGACAATCTTCCACTTCGTCCAAAGAGCGCTGAGCCGAAGTCGGCGCGCGAAGAGCGCTTCGCTGCCCAGTCGTGGGAG
TCACTCCGCGACTCGGGCAATCGAGTATACGACACCGTCCGCGAGTTCGCGGATGTTTTTCCCGACAAGATTCCAGCTGAACTCCCTGCTGACATCCGCA
TTCGCCATGAGATTGACCTCACGCCGGGTTCCAAGTACTGTGTGACGCGACAGTGGCCCCTCCCACGCGATCAAGTTAAAGCCATTGACGAATTCTTCGA
GAGCCGCCGCAAAGCGGGTCACGTGCGCGAGAGTACCTCGCCACACTCGAGTCCGACGTTCTGCGTGAAGAAGGCCACGGGTGGTTGGCGCATTGTTCAC
GCTTTTAACAAGCTAAACGACGCCACCATTCCAGCACAAACTCCGATTCCTCGGAAGGATATGGTACTCGACACCATGGGCCGCACTGTTATTTTCAGCG
CCATCGACCTGATCGATGGCTTCTATCAGATCTTGATGCGACTCAGCGACATCCCGCGCACAGCGGGGAGCACTCCCAGCGGGAAGCTGTGGGAGTGGTT
TCTCATGCCGCAGGGTCTGAAAAACGCACCGGCCACGTTCAATCGCATGGTTTCCCACGTTCTGCGCCCACTTCGCGACTTCGCCCCGAGCTACTTCGAT
GACATCTTCGTTCACAGCCGTGCTGAGGGCAATCGCAGCGCCACAGAAGTTCATTTGAATCACCTAAGACAAGTGTTCCGGGTCATGCGCGAAAACAAAC
TGTACGCGAACTTGAAGAAGTGCATCTTCTGTGCCCCGGCGATCCCGGTCCTTGGCTGTTATGTGGGCAAAAATGATGTCCGAGCGGATCCTGAGAAGGT
CTCGTCCATCTGTGCGTGGTCCACGCCGCAGAATCAGACGGAATTGAGTCAGTGGCTTGGCCTCGCAAATTATCGTCACAAGTACACGAAAAATTACGCT
GGTCTGATCCAGCCATTGTCTTCATTGCTGAAGAAAGCCATCACGTGGTCGTGGACTCCCGAACATCAGTCAGCCTTTAATGCAGTGAAGAAAAGCTTG