Description :
From Genome Similarity Track
Location :
Scaffold_63:3844- 6033
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_63-fgenesh-gene-0.4Conserved gene of unknown function

Sequence
2189 bases(100 bases per row)
GGCGGTCGACCACTTGCTGATTCTCGTGACGCTTCGCTGGGTGCTCCATGAGATCCTGCACGATCGGCGCTGGGTCGCCACGCACGCGTTCCGTGCCAGA
GTAGCCCGTGCGGCCAGCACTGTCGTCGACGATCTTGCCGTGCTTGAGGATCTGGTCGATCTTGTCGACCATCACGTCGCCAATAAAGCCCACCGCGTAG
CGCGCCTGGCGGCCCGAGGTGATCACCTCAGTCGTGTTGCGGATCTCGCGCGCGGCGCGCAAGTGCGAGACGCCCTTGCCCGTGTTGCCAAACTGGAGCT
CGTGCTCGCCAAAGTCCGCAAGCGCGTCCACGAGCTTCTGGTTCTCAGGCTTCTTTGCGGGCGAGCTGCGAATGTCCACGACAATGTCGGGCGGGTTGTG
CTCATAGTCGCGACTGACGTTCAAGCTGCCTTGGTTGTCATGGATCTTGCCATCCTTAAGCACCTGCTCGATCTGCGAGGCCATGCGGTCGCCCACGTAG
TCCACGCGCTTTGCATCGACTCCCGACTTGATCACTTGGCCGTGGTCGCGGATCGTGGTCGCAGCGCGAAGGTGGGTCACACCCTTGCCCGTGTGGCCTT
GCTCGAGCTGGCGCACGCCGTACTCGACAAACGCGTCGACAAGCTTCTGGTTTTCGGGGCACACGGCGGGCTTCTCACGGGCCTCTTCCGCCAACTTTAT
TCGCTTGTGGTGTGGCATCTCCTCCTCTTCTTCGCCGCCATCGTCGTCCTCGTCCTGGTTGTCGCCGTTGCCCTGCGGGTGGTTGCGCTTCTTGCTTGCC
GAGACGCCAAACTTCTTCTTGAGCTCCTTGATCGCCTCGTCCTCCTTGCCACCAGCGGCCTTGATCGCTTCAGCGACCTCGCGGAAGGCGTCATATTGGT
TCTAAGGTAGACGAAGTGGCGGTTGTTAGCTATTGGTGCATCGCTTGAGAGAAAGAGATGAGAGGTTGGAAAATGGACGGACCTTGGGCATTTCGATGTT
CTCCTTCTCGCACTTGGCCACAAGGGACGCCATGGTCTGCTGGCGCGGCTGCTTCACCATCGTGTCGAGCGTTGTGTGGTTGGTTGTTGGGGTTCTTCGT
AAGCTTGAGGGCGTGTTCGACTGTTGTCCAACGGCAGAAAAGCAAGACTGAGCACCGCAGGCCACGTGTCGATCCCTCCATTGCTAAGAGTCCCCAACAA
GGTCGCCAACTGTCGGGTCCGGCTGGCTTGCTCTCCTGTCGCCCACACAACAAACTCTTAACGGCCGAATGGGGCGGGGCTCAAACTGTCGCTTGTCGGC
TCTTGTCGCCCAGAGAGGAAGATGGATCGTGACTCACCACGATTCCGTGACTTGGTCTTCGTGTGAGAACCGGCAAGTTGAACTCTGTGAACGTGGGTCA
TGTCGCGGTTGCATCGGGCGCAGGCCATGTGACGTCTTGAGGTCGGAGCCAAGGACACGTGCTGACCAGAGGTGGAGGTATATCCGACGGGCCTCTGCTG
ATCTCATTGCTTCATGCTCGGGGTCACAGACGTCGCCGACTCTGTCAAGGACCTGCCGCCTGCGCACGGCGATTTGTTCCTTGTCGCTGACGCATGAGAT
CGCCATCATGTGCAGGGTGTAGCACATGCCCGCAGCGCTGATGTCGGCGCCAGTCTTGGTGCACTTGGCATACAGCGTGCCGTTCGTTGCACATGGCCAC
GTCGCTTCAACGGGCCTGTAGCCCGGTTTCATGACGACTTTGGCCGAGGACGCGCACACATTCGCCGCGAATGTGGCAAAGTACCGATGCGTGGCCTCAG
TCGGGATCTTGTCAGTGCAGTTCGCTGGCAGGCAACCTCCGGGCATGAACTGCCACGACGGGTGCAGCACGCAGTTTGGCTGGCTCAGGTCGCGCGGGTC
TGCGATCGTGCGCCCGTTCCGCTCAAAAGCGCCTTTCGAGAGCAGTGCCTCGCTGATAGCGAACGCTTTCCGGTCGAACGTGAACGTCGTGAGGCAGTGC
GCGAGCACGACGACGGGGGTATCCCACGACGATCAAGAACGCAAACCTGAGCAAGTGCTCTATTCTAGTCGATAAAACAGCAGAGCACAGGCGACATACG
TGCAATCGACCAGCGCGTGGAGCAGGTCGGATTGCAGGCGCTTGACGCTGAGCATGAGCACACACACGACCGAGTGGAAAACGATGATC