Description :
From Genome Similarity Track
Location :
Scaffold_721:3844- 5306
Sequence
1462 bases(100 bases per row)
TCTTCGTCCACCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAATAGTCGTACAGCAGACCTCCACATGACAGGTTGGATGCTGGTT
CCCACGTTGGATCTTCATAACCCACCCACTTGACTTTGAACTCGTACAGCACGCTCCGTGTTTGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCTCGA
CTTCATATTAACCGGCAACTTGATCTGGTTCCCAGCTGTCCTCAGGCAATAGTTCCTCATCAAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTACCAA
CCGAGTGTTCGGTCGACTGTTGAACTCGTTGACAGCCTTAGTCTCGCCACATGCACTACTGGGTAAAAGCGATACCCACTTCGGTCAGGCAGTTCCAGCT
CGTACGCAAACTCTTCCACCTTGCGCTTGATACGAAAAGGTCCGTGCCACCTGTGAGCTAATTTCTTCGTCAAGCTTGGTTTGAGGCGTTCCATGTACAA
CCACGCCCGGCTCCCAATCTCAAAAAGAGATCTCGGTGGAGCTCTTGCAGGATCTTCCATCTCTTCCGAAACTTCTGGAGGGTCCGCCGAGTGTTCGTTT
CCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTCGACTCAGGGCATCATTATGTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAGTCTTTGGCCAT
AGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCCAGTGCGTCAGACTGCTTGCCGAGTCCTCGTTTGAGTGATGACGACATTGCCCTC
AACGTCGACTGAGCATCCCAACCGTGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAATACCAGCTTCTCCGCGA
TTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGAACCCATCACCGACTTCACCGAGCGTTCCTGCTGTCCATTAGCCTGTGGCCG
ATAGCTCAAAGTCGCTCTTGATCTTGACTGCATCATCTCTGCAAATGCTTGGAACACCTCGCTCATGAAGCGTGGGTCACGGTCGTGCCTTATCAGTGAC
GGGGCTCTGAACCGTCGGTACACACATTCTTCAAACACTTGGGCAACACTCAGTGCAGTCGTATCCGACATAGCCTTGGCAATAACGAATCCCGTAAACG
AGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACAAAATCCATCGAGACGATCTGGAAAGGTCGTTCGGCTAGAAC
GTTGCCGGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTAGACATGACTTCACATGCTTCTCCACGTCAGCGTACAAGCCGATC
CAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGGTGTCCTCCTTCCAG