Description :
From Genome Similarity Track
Location :
Scaffold_26:384380- 385456
Transcript NameFunction/comments
Physo_133480zinc-binding oxidoreductase

Sequence
1076 bases(100 bases per row)
AAGGGTCAGCGCGTGCTCATCCTGGGCGGAAGCAGCGGCACCGGCGTGTTCGGCATTCAGATCGCCAAGGCGCTGGGTGCTGAGGTCATCACGACGTGCA
GCCACCGCAACGTGGAGCTGGTCAAGTCGCTGGGCGCCGACCAGATTATTAACTACACCAAGGAGAAGTGGAGCGACGTGCTGGCCGAGCACTCGATCGA
CTTGATCTACGACTGCGGCATGAGCCGGCCTCGTGGAATGACGCCGCGCAGAAGGTGCTCAAGGAGAAGACCGGCATCTTCGTGACAATTCTGACGGTCG
ACAAGCCCATCGAGTCGCCCATTGGAGCTACCTTTCACCAGATCTTCAACGCGCCATGCACCGAGTACCTGCTGGAGGTCAAGAAGCTGATTGACGCTGG
CAAGGTCAAGACGATCATCGACTCGGTGCACCCGCTCGAGAACGTGATGGAGGCTTTCAAGGTTCAGATGTCCAGCCGCGCCCGGGGCAAGATCATCATC
GAGATCGCCAAGGAGTAAGCAGTCACGAAGTGCCAATTGGATGTAATACTGTAGAAACATAAAAATCAACGGAGTGTTGGCCTATACACAACTGTTCTGA
TTGAAAACCGTGTCACCTCGGTAGAACATGCAAAACTGTTTGGTTTCGGGGACCCCGGCAGGTTATCCTATCTATTGATGCATCTGCACATCTCGTGCGT
GCAGCACGAGGCGAAGCGGAATGGTGAATCCCCATCCTGCTTCGCCTTCCCCATTAGCGAGTAGGTGATCTATTGCGAAATTCGTTGTTGTATTTGGGAC
AGCCTACGCGCCCAGGTTTCCCAGGTTAGAAACATACTCAGATTTCTGATTATGCAGGTATTGTCCAGGTGATGCCCCAGGTTATATCCAGGTATATGAA
TTATGAGCGTTATCAGATGAAAGTAATTTAAACAAGGATGGTTAAATTACCAGAACAGTTAATGTCCAGGTTAAAAACCTGGAAAACTCATGTGCGTAGT
ACTTGATGAAAAGTGAAAATGACGGCCTACAGGCTGTGTCGGATGCATTCTAGCCATTCATTTCCTGTTTCAGTGT