Description :
From Genome Similarity Track
Location :
scaffold_83:38433- 53601
Transcript NameFunction/comments
Pl_110182hypothetical protein PHYSODRAFT_538125
Pl_110183conserved hypothetical protein
Pl_110184hypothetical protein PHYSODRAFT_538135
Pl_110185hypothetical protein PHYSODRAFT_310092
Pl_110186conserved hypothetical protein
Pl_110187hypothetical protein PHYSODRAFT_284561
Pl_110188hypothetical protein PHYSODRAFT_358780

Sequence
15168 bases(100 bases per row)
TTATTGCAAGTTATTAGAGGGCGCTGAATCCTCGCCAGTCCACGCGGTTTGCCATAGCCACCACTACTAAGAGTGATACGTCGCTCGTGGCACGTCTACC
AGCGACCGCGACCGCGGCCACCGCCATAGCCACCCCGGCCACGGCCACCACCGCCTCCACGACCCACAAGGTCACGCAGCTCACGAGGAACCTCCTGTTC
AGCCTCCTCCATGATCTTTACCAGGGGCCCAGCCAGACGACTGTTATTGCTGGCCGTAAAGAAGGAAATAGAAGTACCCTTGTTGCCAGCACGTGCCGTA
CGACCGATACGGTGAATGTAGTCTTCGATGTTTTTCGGCATGTCGAAGTTCACCACGTAGCGAATATCCTTGATATCCAGACCACGAGAAGCCACATCCG
TAGCCACCAGGATCTGAGTCCTACCATCCTTGAATTCGCGTAGCACGTAGTCACGTTCTTCCTGTGACTTGTTACCGTGGATGGCCTTGCACATGAAGCG
AGTGTTGCGCAAGTTGCGGCTCAGCTCATCAGCACCACGCTTTGTCTCACAGAAAATGATAATACGACCACCCTCGTAAATGTCGCGCAGGTGGTCCTGC
AGCGCAGCGTATTTTTGGTGATCGTCCATGACCTCCACAATCTGCTTGATCCTCTTGTTTGCGGTCAGATCCAGCGAGCCCACAGTCACCTGAATGAAGT
CCGTCAAGAAGTCATTCGCAAGCGAAATGATCTCCTTAGGCCACGTCGCCGACCACATCAGCGTCTGACGATCGGGGCGGATTTGACTCACGATCTTGCG
CAGTTGCGGCTCAAAACCCATGTCAAGCATGCGATCAGCCTCATCAAGCACCAAGTAGGTTACGCGACGCAGATTTGTCTTGCCCATGCTCAGCATATCA
ATCATACGACCAGGCGTGCAAATGCAGATCTCCACACCGCGACGAAGGTCAGCGATTTGACCACCCTTAGGGACACCTCCGTACACGCATGTGTTCTTGA
TCTTGGAGCTTGCACCGAACTTGTTGCACTCTGCCTGAATCTGCACAGCCAGCTCACGCGTCGGGGCAATGATCAGCACAATCGGTCCATCACCAGGTTG
CAAGTAAGGCTACAAAATACATCACACAAAACGTTAGGTCACAAGATCGAACTACTAGGCAAGCAAGGTTGCACGAGAAAGCAAACACAAGCGAGCGCCG
AGGGATTTGAGGTGTTCGCATGCTGCTTTTTCTTCTGGCCATCGCCCACAACGCACCAATGCAGTTTTCGCACCGATCGATTGTCAGGAGGACGTCAGCA
AGAGAAGAAAAAGGCAGCCGTGCTCAGCCAGCTGATCCTGTATCGGTTGTGCCGGCATATCTGTCGAAATCAGCCAGTGGATTTCTCTTTCCTTCACCAA
CGTGTTGCCACGAGAAAGAGAACCTATTCCACCAACACGACCAGCACTCCAACACAGCAGACTGCGATCCGAATCAACCTCCGAATCAACTGAAGTGACA
AGCGACAAGCGCGCAAACGTCGCTCAATGACAATGAGATGAGTACAATGTACTCCCAAAAGCGCGCATCTACGTCGATCGACCACAACCTGAAGACCTTG
TCAAACCCCCACGCCTCACGCGTGTCCCGTTCAGCACACTAAATGTATGAACGATTGTCGTGCTGAACACAACTTGCAATCACTTCCATCAGCGCACTAG
CGCCACGGAAGATGCGTCCACCAAAGAACAAAATTCTCTGAAAAGAGTCTGCTGCAAAATACGAACCTGAGCGTTAATGTGCACGATCGCGGGAAGCAAG
AAAGCCAGCGTCTTGCCAGAACCCGTCGCCGAAATGCCGACCATATCACGTCCAGACAGAGCCATAGGCCAACCCTGGCACTGGATGGGCGTGGGCTTGT
CAAAGCCCAGACGCACAACTTCTTCCAGCACATATTCGGGAAAGGATGCCTCCTCGAACGACAGCACGCACTTGGGCACGCCCTTGCCGGCTACAATAAT
CTGATTGTCGCGCTTCCATTTCTCGTACTCGTCCTCCGAGCGCTTAGTAACGTCTGGGTGCTCGTAGTAGAAATTCTTCTCGAACACCGGCAGCTTCGAC
AAGTCCCACTGGATGTGCGTATCCAGGTTGGAGCCGAGGTCGCCGCCACCTCCGAAGCCGCCACCACCACCGCCCCCACGGCCACCTCCGCCGTAGCCAC
CGCCTCCGTAGCCACCGCCACCACCACCGCCTCCATAGCCGCCACCACCGTAGCTTCCACCTCCACTGTAGCCGCCGCCACCTCCGCCACGGGAGCTTCC
ATAGCCACCGCCACCGTAGCCGCCGCTGCCTCCGCCGTAGTCACGACGCGAGGAAGAGTCGCCGTATCGGTCACCGCCGCCGCCGTACATGATCAAGAGT
GATGGTCTTCTGCCGTTGCGCGCTACCGGTCGTTTTGGCGAATGAAGAATGCGCACTGGCGACAGGGCAGAGAGCGATCGCTTTAGACAGGGAAAGTTTA
CCAGGCGTTTTGGTTGGCTCCCGACGGACGGCGATCAGGTGTGCCATTCGCGGAAAATTCGGCAGGAAGCACTGCGATTGGACGAAATAAAAACGATCTT
AGCGGAGCCGTTGATGACGAGTCTGAAGCAGGTAATAATGGAGGGAGTGCATGAGCCCGTTGTATTGTGCGCTTCAGAGCAAGCGCAGAAAACGGTGGGA
CGGGGTCCTTGCCTCGCTCTGAGAGTTGTTACGTGTGGTGTGGGGAACTACAGCCCCGGTCTAAGCCCATTACGCTAGGATGGTGCGCTCGTACGACGCG
AACTGCTGGTTGGCCTCCGAGATGCTCACCTCGATCTTACGCGCGCCACGCTCCTATAGAGAGACCAGGTTAGCAAGCAAGCTTTGAAGTGAGAACGATA
TCAAGTGATTCCTTACCAGGAGCGCAACAAGAGTAAAAGCATCGATGAGCTGGTTGCTCTGTAAGACAAGTCGTAGGAGTTTGGAGTTAGTAACAAGATT
CCATCAATGCAGAATGGAAAAGTGCAGGTACATACAATGTAAATGGCGAGTTCTTCAGCTGACGAGTGCACAATCGGCAGCAACGAGCAGTCTGCCTTGG
GGAAGCTGAACTTCGCCATGTCTTCCGTCAGAATGTGTACATTCGTGCCGTCAAACGAAATCTGCGTTGGATTACAACCCAGTCAGCATCCAAAGTAAAA
GGCAGCACCATATAAGTACAACTATGCAGCCTCTTACCTTCAGGGCATCACTATTCATGGGCACAAGGAATGATTCGTTGAGGTCTTTGCAGATAACCCG
CGAGATCTTTTTGATCTCACCAAAATCCACGACGTATCCATCCGGACCAACCTGGCCCGTGATCGTGACGGCCAAACGGTAGTTGTGTCCATGCAACTTT
TCGCGGAATCCCTGGAACACGAATGTAGTCAGTATTTAGCATTCCATCCACAATATTAGTCATGAGATACCTTATAGGCGATGAAATGCGCCGCGTTGAA
CTTCATGTAGTCCTTGGACACATGCACCTTGAACACTTCATTGTAACCACTACTCATGGGGTTGGGCGTAGGTAAGTGAGTCGTCGGGGCTACCACGGGT
ACTGCAGGAGCAGCAGCTACAGCAGTAGATGGCACGTCCGTCTTCACCGTCTGTACAGCTCGGACAGGTGTCGATGTAGCTGAAGAAGGTGACGATGCAT
TGCCGCGGAATGGCTGAATCTGCGCCTTGACATCTTCTGGAGTCTTGACACAGCCGCGCAGGTGCGACGCCCAGCGATCCACGTTGCGCGACGTGATCTC
CTTGTCACAGTAGCAGCACTTGACGACGCCCTCTGCAACGCCTCGCGACACGTACATTTTGGCGATGGCCTTCTGGTCTGCTGTAAGTTCCTTGCCCATG
TTTGCACCCGAGTGTCGTCTACGTCTCTTGTTGTCTGGTGTGCTTCCAACTGACTGGGTCTGGGCTTCCTGTTCGGCGATCCTTTTCTGCTCCTCGTCCA
CTGACTGCATGGGCTCAGCAGCTCGAAGCACTGGTGCGGACTGCTCTCCCTCGTTGAAAATCAACCTTGGAGAGATGTGATTGGTGGAAATAGGAATGGT
GTACTCTACACAGTTTCAATGATCGTAACAGTGACAAGCATGCTTCAACATGTAGCGATTAATCGTAAGACTGAGGCGAAATATATAACGATGCATACCA
GCAGCTTGAAAGTGCGCAGACTTCACACACTTTGCGGCACGCTGGCGCCGGTGCTCTATTGGTCTGAGACAGCACGCGGCACAACACTCAAAAAGAAGTT
CATGCTCACGCCGAGCAGCAGGCCGACCTTTTGCTTGCGAGGAACGGAGCGGTCGAGAAGCTGATGAAAGATACATTTAGATACGTTAGATAAGAAATTG
TAGGCATCATTCGCAGCAACTGATACTCACCATCAAAAGCATAAATACACCAAGCAGCAGGCCCATCAAGAATCCCCACAGAAATTCAGTTCCAGTGCCT
TCATTATCTGCTGCCAGAATCGAGTTGTTCATGCCATTCATGTCGATTTGCGTGTCCATCGCAATTCGCGCCGTTGGCACAACATTTAGTGCTGCAGAAG
CGTCAATCATCAATTACAACAGCAACAAACAAACGTCGAAAGCTGCAAAGATTCGTACCAAACTCGGACTGTGGTCCTTGTGACGCCATCCATTCCTCTT
CCAGTCTGTATATCCGGTCCTCACTACTCTCGCCAGGGACACGTTCCGCTTGGCTGATATACACCGAGAGTTGTGGGTAGAAATACAGACGCAGCGCCTG
GGTCTCTTCCCGACTAAGTCGGTCTCGAAGTCTATCAAAGCCTCTTCTAGTGGACGGATCGTCTCTCTCCTCCGGTTCACTATCAGTCGCCGCCATCTAT
AGCATGTTATCGACGTTTTATCACAGTTAAACGTCAAAAATGTCTACAAGTCTCTCTCTCATCTCTTGTACCTGATTGACAACAGCCTTCGGCGGCGCTG
AGCTGATAGCACAGTGGATAAAATCCTCGTTCTTGACCTTGCAGCTTTCGAGTGTGACTTTGTCGTCCGACAGCATCTTGCCTTGATGAATTAGGCGCAG
GAACTTGCCCTCTGCATTGGCCTTCTTCTTCACTAGATCCTTGAGTTCCCCCACACTCGCTGACGGTGCGATCTCCACACGCAGAGGCTTCTCACTGAGA
GTCTTGACCTTCAGCACAATCTTGCCATTATTGTCGTCATCAATTGTGATCCCCACGGAATCCTCCGACAACTAAAATGATTCACAAAAAGAAAATCAGA
GTCATTTCCCTCTTCAACATGGAAAGCACAAGAGAAGCAACGCGATATCTACCAGCGGCTTGTCCTCCGTGATGTTCTCGGTGTGCTCTGGCTCCATCAT
GCTGTCCGGATCGATCGATAAGGCGCTCGCACGCCTTCCACGACCGCTCAGCGCCTGCTGCCCACGCTGCTATTTGGTCTTTGTGCGGTTTTCTCGCTTT
TTTACAACTGCGGCTAGGGATAGTCGAGCCAGTTGGATCTCTGTTCTACAATTGGCTAAAAATAGAAAAATCAATAAGATTAAAAAAGTTTATTTCAGCC
AATCAAGAGAATAGAGATCAAACATATCGGCGTGTGTCAATGGCGACCAAGGCGCAGGATGCCATCGTCGAAGCCAGATCTAGGAGCGACGCTGTGCAGG
TAGCAGTACGAGTGCGGCCGTTGAGCTGCAACGAGACATCACAAGGGTCGGAATCGTGTGTGGATGTCGTGGATACGAGCGTCCTATTGGCTGAGAAGCA
GTTCAGCGTCGATGCGGCATTTCCAGCAGCAACACTGCAGGTTCAAATGCGGAAATGATATTGTTGTATGATGTAATGTATTACACTAACATTACTCTGT
CGGATGTAATGTGTTGGCTGCAGGAGGAGGTGTACAGTACGTTGATGTCGCCAATGATCGACGAGTTCTTCGACGGGTATAATGCTACGGTGTTTGCCTA
CGGACAGACAGGATCTGGCAAGACGTGAGTCGGCAGTAGGTTGTTGCATTTAGGACTGTATTAGGTCTGACTGATGTTGCAAAGGTACACGATGGGCAAC
GAATTCACTTCCAGTGTTGTTCCGACGGAGCGTGGAGTTATTCCACGCGTGATAGAAACTGTAAGGCGTGTAGAAAAATATTGTATGTAGAGTTGTGTGT
CTTGGATCTTGACCGTTCCGCGCGCTTGCAGATTTTCGAGCGCGTCAACGCCTCTGCGAACCCGCAACATTTTGTGATCAAGCTGTCGTATTTGCAGGTG
CGTGGGTACTGTTTGTATTAGCATCGATGTAATGTGTAGATGGACTAAGTCGTATTTTGCAGGTCTTGAACGAAGAAATTCATGATCTACTTGGTAAATC
TTCCCCTGATACGTCACATCCAGTCACCACGGGACTATCCGTTCGCGGTGATGGAGATCGTGGAATTATTGTGGCTGGATTAAGCGAACACGTGGTGAAT
TCGGCTGACCAAGCTGGAGCGCTGCTACGATCTGGGGCACTTTCACGTGCCACAGCTTCTACAAGTATGAATGCTCACTCTAGCCGTTCTCATGCCATTT
GTACTCTCATCATGGAGCATCATGAAGTCAGTGCTGTAGAAGGCGGCAAGGAAACACGATTTTCTAAGTTTCATCTCGTGGATTTGGCCGGCTCCGAACG
AGTCCGACGTACAAACTCGGAGGGCGCACGTTTTAAAGAAGGTATCAATATCAACCGCGGATTGCTTGCCCTTGGAAACGTGATAAATGCGCTGTGCGAA
CGTAGCCAGACAAACGCGCTGGTAACCCACATACCGTATCGTGACTCAAAGCTAACGCGTCTACTCCAAGACAGTCTTGGCGGGAACAGCAAGACACTGA
TGATCGCGTGCATCAGTCCTGCTGACGTTAACTACGAGGAAACATCGAATACGCTGCGGTACGCGACTCGGGCACGGAATGTTCAGAATCAAGCTGTCAT
CAATAAGGAACGAAGTGCTGAAAACGAGGTGATGTACCTGAAACAAGAGCTTGAAATTGTGAAATTACAACTCTTCCAGCAAACTCACGGCATGAACAAT
GATCCAATTAATGCGAATCACCCTAACTCGGGTATGAATACCCTCGAAGAGGAGAATCGCAAGCTAAAAGAGGAGCTTTTACTAGCAAACAGTGCTAAGG
ACAAATGGAAAAAGATTGCGGATGAATTGGCAGGCAAGTTTGCCAGGGAGTCCAAGCCGGACTTAAGCAAACCAATTCCGACTTCGAAGCTCATCAAAAA
TGGAATAGCAGTTGAGAGGGATGTGGATAAAGACGACTGTGGAAGCAGTACTAGTCAATTGTCACGTCTGGAACTGCTTAGAAAATATCAGAGCCAGAAA
CTTGCAAAGGAAAGCTCTGTCCTAAAGCGGAAAACTGATGGAACAATGTCAGCAAATAAGCGAAGTCGGACGATCATGTCACCATCGCCTAACACTCCAG
ATATTGGGAAAAGAAGTTTGGGCTCAAGGGTGCTCCCTGCGTCCCGTAAAAAGACCGAGAATGGAGAAGCAGATGCCTCCTCAATGAGGGTTATCAGAAA
ACTATTGCAGCAGATATTTGAATCGCAACAAGCGATTTATAGAGCGAAAGAAGCAGTTCGTATGAATGTCTCTAACAGAAAAGCCTTGGCGCTTGAGATT
TCACAGCTGAAAATTGTGTTCTCGACTGATAATATGGAGAAGGTGGCTAAGTTGCAAGATGATCTTCGCGCAAAGACGGCTAATATCCGAGTTCTTCAGC
AAAAGTTAGCTAGCGTCGAGAAAAATGCGTCGCTTCCTCCGGGGCTTTTTCCTGCGAAGATTGACACTTGTCACGAATTGATTCGGTATATCATTGAAAC
GTTGATGGAAACAAAAGAGGAGTGTATGGTCCTTACAAACTGCAATACTGAATTGGATACCGCAAACGAGAAGTTTATGGGCGAGCGAGAAGCTCATGTA
AAGAAAATCCTGGCATTAGAGGCCAAACTTGATGAGGTGATGCACGAATTGCAGGCTAAAACAGCAAAGAAGAAAGCAGCTAAGAAGCGGAAAGCAAGGG
AGTCGTATGAGACGATGGACATGCTGTTCAGCAGTAGTGATGAAGAAGAAGATAACAATGAAGCTGACCCAGATTACGTGGATGATGAAAGCCGTCGAAA
ACCAAGCACTAAGAGAACGAGAGACAACTACACTTCGGCATCTAAAGCTTTGAAGAGCGCTGATGTAATGGATGAAATTGATGAGTTGCTGGAGACCAGT
ACAGCTACATGCTGTTCCTGTCACGGTAAATGTGCTACGAAGGCTTGTGCGTGCAAGTCGCAGAACCGTGTTTGTAGCGAGGAATGTTCATGCAATTCAA
GCAAATGCCAGAACCATAGAATTAACGATACCCCAGCCAGTGGTGATACTCCAAGTATCAGTTTTTCTGAAGAATGCGCAGATTTAGCGATCAATGTTTT
GACTTCTTCAACTCCAAGAGATAGAACAGCAGAGTTGATGTCGTCTTGAATATAACACTTCTGAATGTATAGATTGGTAGCGTTAGGATACTTGCTTGAC
TTTCCTCATCTGCGCACTGGTATGAAACACGTTCAAAGATGTAGACAATCTAGCGATGTAGTCTTGCGGTCAGATTAAGTAATGTATTTTGATATACCGC
TGTGGATTAACTAGTGTGTGCTGTCTTCACCTTTTATCTTGTTGTGCTATCCGAGCGATAGATGGTCTACATCAATAATCTCGTCATTATGACAAATCCC
CAAAGAGGTCCATGTCTAAGGGTTCAGTCTTTTCCGTCATGAAGTCGGGGTCATCCTCGTCGTCAGTATCGGAGGAAGCATGGTGACGAGCCGCGGCCTT
TTCGGTACGACGAGTTGGTGTGCGGATGCTGACTCCATTCGAGTTCTTGCCATTACTACTCCCGACGCTGCCCGTCCCCTTATGTTCACTTGTCCTAGAT
CGAGTACGGATGACCAGCGCCGCCTCCTTGGGTTTCTGGTAGTGATACGTACTGTTGCTGTTAGACGCCGATGAGTATTTTGCGCGCAGTGCTCGAGTCT
TCTCTTCACTTTTCTTCGCCAAGAAATTCTGAATGAGCTGACGTTCATGATTATTTATGTACATCATGTTCACACTTGTGTCGATCACCAGGAAGAGCTC
TTGGTACTCGGTCTCCTTGTGTGCGAACGCAGCAGCGGGTGAAAAATCATAGGAGACCACCTCGAGAATATCGATCGAGTCACGATGATATGGAATTCGC
GCAAAGGCCAAACGCTCCACGGGAATCAACAATGCAGCGCTAGCAGCATTTGCCAGGTATGTTTCGGGGTGGTTCTCCTCCTCAGAAGTGGATATTACCA
CTTCGCGTCGCATGTCCTTGGCAAAGCGCCACGTCGCGCGGTTCACATACGCAAATTCCACAATCCGATGATTGATCTCTGACGTCTCCGGTTCTGATAA
GAGCTCTGCCACAATGCTCCTTCCTTCATATACTGCAAGCTTGGATGCATCCACGAGTTTTTGTCCATCCACCAACACACTCGTCATTGTACTTTGGCGC
AAGTCACGCAAGCGGATATGAGATGGAGTCAATTTGCCTTCTTCTGGGTGCACTAAGCTTTTCGCCTTCAATTCAGCCCATACCTTTTTACGAATATCCT
CAACCAGCATCTCCTCGCTGATGACCACCTGACTGACAAATGTCAGCATTGTGTCATCTTTTCCGGTCGCTACCAGCACTTCATCAATATCAAACAAATC
CTGGTTGTCACCATCCGTCACGGTTAATTGATCCTGGTTCTTTGGAGAAGTCGAACTTGCATTTGTCGGGCTATAGAACATCAGTCTGAAGTTGTATTCT
CCCGTGTTCAGTGGAGTACCCTCCAAAGCGAAGACTGTATGATTGGAGCCAATCGACAATTTGGACAAAGTGCTATCGATCGCCTTGATTTCTACACCAG
CGCTGTTGATGCCTCGTAGAATCTTGAATTTGTTTGATGGAAGACCAATTTTGGCACTTATCCGCTCCTTTAGAGTGCGGATAGTCTCTCTTCTGTCGAT
GCGAATAGGCTCCGCTGGGTTAGTCAAATATTTGAAGTTAACCGTGATCATGTTAGCTTCTCGTTCAAAAAATGCCTCTGCCGGTGATGAAAGAGTGAGG
TCTGATGTCTCCTCGAAATATAGCTCAGTCCCATTCATCAAGTGTAAGTCCACTTTCAGCCGCTGGTTCCGTGTCCGCTCTTCGTCGTTTGCATTTAGAA
CTTTGGCTGCGGATATGCTGTATGTAGTTGCACTCTTCTTGATAAGGCGAATCTTTTGATCAGCGGGAATAGAGAACTTCTTCGCAATAAGAGCGCAGAG
TGATCCAATATTCGCGTCCTCATCCACCTGAATGCATCTCGCCATATATACGTCCTGTGGTGTTTTACCACTTCCGTCTTCATCTTCCGGGTTGACAAAC
CGGCGAATAAAGAGCTGAAGTTTTGTTGGGTCGTGCTCTTCCCACTCTTCATCGTCGGTTTTAACTTCGAGGAACATCTGCTGGCCAACGTAAATTCCTA
GTGACGACAAAGTCATGTCCTCCTTGTCATTGTACGTGTCAGACAGCAAACAGTTATAATCGTTGTATCCGCGCAACCGGACATTCTCTATCGATGGGAC
CACAACATCCTTTTCCTTGGCAAATTCCTCACACGCCATCTCGAGCGCTTCGCGGATCGTCGCGGTCTTGTAGACATAAATGAGCTTCTCTAAATTTTTG
GGCTTGGAACCTTTCATGAAAAACTTCACCTGCACTTTTTTGGCCATTTCAATACGTTCTTGTTCAAGCCTACGAATTTTTTCCTCGTCAGCATGGATTC
TGTCTTTCAAGTACTGCGGAATGCTATCCGGTAGGATCACATTCACATTCTTATCGGCATTAACCAGACGATAAAGTAGCATGTATGCGCAAGTGCTGTA
ACGCGCGCTGTATCCAGAGCCACTTGTACCTCCAAATGCAGTCTTTAACTCCGAGTCTGAAATCTCGCTCACATTGGAGTCATTAAAGTTGTACCATTTG
CCAGTCTCTAGAGATTTTATGTACGCGTAGTAATGTCCACCAAGCGCGCTTCCAGAGTGAATCAGAACCGAGTACAGCTCGTACACATGGGGTCCTGAGC
GCTTGATCATGACGTCTGGATCGAAAGTGGGGCTCCATGTGTCAAATGAAGTCGCTCCATCAACGTCGTCATCTTCATCCTCCTCCTTCTCATCATCATC
ATTTATAAACGTCATTGGCTGTGATTCATCCATTGACGACAGCCGGCGCATACGCTCACTTACCGCAGCAAACCCTGGTGTCGGAGGAGGCGAAGTAGAT
GTGGGTACAGCGTCTTCCTGCAATTTATGATTTTTACCTTCCAATACGTGGCGCTCCAGTGACATTTTTCTCGCAATTTTACCACGAACGCCACCATTCT
CATCACTCACGTACGAGTTCATATCCAAGTACTTGGGGAACGTCACCTTGTTGTGCAGTTTAATACGATTCATCGTGGCATAGTCAAAATCAAATCGTTT
GAGTTGTAGCATCAGAATATATGGTAACTTGGAGAACTTGAGTCCCTTAATTGCATCTCGTTTCACTTTGCACCTGTCGCACATCCACTGGTTCTCCTTT
TCCAGCATTTCCGGTCGCAAGAACAACTCAATAGCCTCCTCAACAGTCTTCATCATCTCTGTCGATCCAAAAGGTCTAATGACCAATGACAAGTCCAAAA
AGTTATCAATTCTCGAGCTCTCATATCCACACTCACAACACTGCACGTAATCCTTTAGTGCTCCCTGGTACAAATCATTCACCAGATTCTCGTTCACTGT
GTCTTTAAACGACTTTTCCAGTGCATCCAGTAACACTCTGCACAGTTCTTGTACATCATGTTGCTGGAACACATCAGCTCCTGTCCATCCAAAGCTCTTG
GTCAGAGCTTTAGTGGAAATAGAGTCTTGTGTCGTCAGTTGCAATTTCGCAAAAAGGTTTTGCAATTGCAACGGGATATTGTCTTCATCTGCTTCTTCAT
CTTCTTTCTCTTCTTCTTCCACCTTCTTCACTGCATGACATGTCCAATTGTACAGTCCTTGACGGAATTCTGGCGTCATGAACATGCTCTGTAGTAGACT
GTTCATGTAGCACGTGGCTCCCTGGTTAGACAGGCCGGTGAAGGCGTTTCTAGGTCTGTTGTAGCCCCCAGAACTGCTGTAGCTGCTGCCTCCATTGCTT
GTGTATCCTGGAGAGTCGTAGAGACCTTCAAGGCCTGAAGAACTGTACGTCGTGAGAGCTGTGGACTGCACACTGGGGTTTGTCGCCATGTCTGCGTCAT
CTTGATCGTCCTGGGCACGCGGCAACTGCGTCAACACGGACGCAACTTGTGCACGATGCTGCTCACGAGAGCCTTCGTCGTCGTCGCTCGAGTCCCAGTA
CCCTGACGTGGTTTTCGGTGGATCTACAGGGCGCCAGTCACTCATGCTCAGGTCGAGGGATTTTAGCTACTGAGATCTAATACCGGTGGGGAAGACTGGT
GTATTGTACGTGAAAAAAGAGTACCGTAAAAGAGCAGATAAAGTGACAGGAAGGGATCTGGAGTGACGAACGAAAATGACGCTACATGTATGCAAACAAT
TGAGCTTCTTAGATATCGTCGCTGGTCTGACGTCCACGAGTTTCAAAGGTTCTACACCATGCGGGGCGTGGGAGACATGTTCTTTGCCAACGGTAGTTCC
TCGTCGGAATCTTCCGAGCCGTAGTACGCCCGGTCCCGCTTGAGCGTGAACGTGTCCGAGAGGAAATCCAACTCGCCTGACCGCAACTTCTCTTTCCGCC
ACATCGTGTAACAAACACCCATTGCAATAGCGTACAACATGGCTGGAGTAATATAAAATAAAACCATTCGGCGCAGTTGCCACCACAGCAACACATAGAT
AACCATAATTAACACACAAATGTTAGTCCTCCACATCTCCAACATCATGAGTTTTAGGCAGCTCTTATTGAATACTGCGGACGCACCGGCTTCAAAGCAC
GAGTTGGCACCGGAATTGGGCTTCTTGGCGTTGTGAATATACATGGGCTGAAGTTTCAACAATGACCCCACCACCACCTGCAACAATACGTACAGTACGT
ACAGCACACATGTATAAGTATAAGAGCTAATACAGCTGCATCACAGGGCGCTACGCGACTACTGAACAGCGTACCAGGAAGACGAATCCGACAAAGCAGA
AAATGGTGCCGCACAAATAACCTATAAGGAGCAAAATAAGCATTGGTAAAGAGAGTAGACGCAGGTTAATCAACTAGACACTGAAGATAACGATATAAAG
CCGTCATGAACACGTACGTCCCCCGCTCATGCCGTCTGATACTCGTGGACTTGTTCCTTCTTATGAATTGACGTCAATCCGCCCCTAGGAATATTGACCA
ATAGTAACTCGTTACATTGAATATGGGCCAATCAAATATAATCCACGTGGATACACTGCTCTGAACTACTTTGATGTGGTACACACTACTTCGATGAGTA
ATTCATGTGGCCACGCTATTTAATGGGCACCACGTAGTTTGACAGTTGAAGTTTACGTCAACTGTGTCAATTGCACTCGTCCAGCAGTATTGTAGCAGTC
TCTGATCTGCCATGGGTGTGGCCAGGAAGTTACGTGTGTTGTGCATGCATGGATATCGCACCAATGCCAAGACCATGGAGGATCAGACCCGTGGGCTGCG
CAAGGCACTGGCACCGCATGCCGAGTTTGTGTTTTTAAACGGGCCCATCGAGGCCCGTGGATCTTCGGACGACGTCATCGAGAAACTATACGCTGATCAC
AAACCCTTCTACGAATGGGGTAGCTTCATTGAGCGCGAGCGACCACACCGACTGGACCCAGAGACGCAGGAGATCGAGTATTTGGACGGCGGATGGTATC
ACGACTATGTGGACTGGGACAAAACGGTCAAGTATATGGACGAACAACTCCCCAAGCTCGGACCCTTTGACGCTGTCGTGGGTTTCTCCCAAGGTGCACA
AACGATGACGGCACTGACGATGTGGTACTTGCATCATCACAATAAGCGCTGGTGGAGGTGCTGTGTGAGTGTTTGCGGTCCACGGGTTCGTGGGGCTGCT
CTCCGTCCTCTGTTCGAGACCCCGGATGGGACGAAGCAGTTGGTGCCAATGCCATCGATCCATGTCATTGGCAAGACGGACAAGTGGCGTAGCGGCTGCT
ATGAGATGGTGGATATGTACGAGGACCACCCAGAGGGAGCAGCACGCGATAAGTTTGTCTTCGAACATGACACCGGTCACCGCTTCCCGACTGGAGAACG
ACACGAAGAACTCTACGAAGAAGTGGCACGGATTATTCGCTTACACTGCGAGTAAATGAGAAAGAATAATGCATTGGTCTGTGTGTAGTAATGGTTCTGT
GATTCAACAACTTAACCAAACGTTTGAATCATTCAAGAGTTTGGTCACCAATCATGAGTCATCACCATGACGTTGGCAAAAGTAGCGCTGGTCACTTCAA
GAATTGTTTTAGTGTGATTCCTTGATATTCCCTTATTTATGACGAAATAAACTTCGCACACCATGTAGAACATTTAGACGCGCTCTCTGCGTTGTGTTAT
GGCTCCGTATGCAGAGTTCATCTTTTTTACAGCTCCGTTTGAGGTCGTGGACGAGGTGATTGAATGACTTTATGACGATTACAAGCTATTCTACAAGTCC
TTGTGATACAAATGTGTAGATCCTGTGTTGCTTGCGCAGACAGGCTGTGTTGTTTACTTCACTTGAGGAAGCGCAGATTATGAAGGTTGGTCGCCAGCTT
GGTGGCAGTGAGAACGGATAGTATCACAATTACGTCGATTTCGATCAGGTAGTATATCGACAAACAACTACGAGTCGTGGTCCATTCAATGTTGTCATTG
GCTTTTCTCAAGGTGGACAAAGGTTCACAGCCTTGTCGATGTTGTATCTGCACCAATGAAATGAACGCCATTGGAAGAATTGCCTCATTTACTCAGTCAT
CCGTGATATAACTCTCCAATGCACGTGCCATTCACATCATCAGTAGAAAAGATCAATACTACAGCATT