Description :
From Genome Similarity Track
Location :
Scaffold_995:3843- 5145
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_995-snap-gene-0.3Histone deacetylase family protein
Pytul_var.sporangiiferummaker-pug3_contig_995-snap-gene-0.4Sporangia induced 28 kDa inner dynein arm light chain

Sequence
1302 bases(100 bases per row)
TCCTCAACGTCCCGTTGAAAGCACGCACGACATCCAAGACGTATCGTGAGCTGTTCCTCAGCAAAGTGTGGCCTCGCGTCGTGGCATATCGACCGCAGCT
CGTGCTCATCTCGGCAGGATTCGACGCCCATACGCAGNNNNNNNNNNGACATCCGGCTGCAGTCGGACGACTATTACTGGATCACGAGTCAGATCGTCAA
GATGGCGTGGCAGTGCTGCGACGGTCGCGTCGTGTCGGTCCTCGAGGGCGGATACCACGCACGCGCGCTCGGGGACAGCGCCGAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGTCGTGAGAGAAAAAAGACGTAGAGACCCAGCAGCCTATATATATTATT
TTGTCGCTGTTTTTTTGGTCATAGAGGTTAGAAATCGTTGTGCATGTTTCGGTCACGTTAAAGCGGAGAGCCTTTCTCGTTTGTAGAGTACTAAATAAAC
GACTTGTCTATGCGAGGCATCGTCTACTTTGGCGCGGCGAGTAAGGTCTCGAGACTCGCCTTGAGTTGGTCGTTGGCTTTGCGCAGGATCTCGACTTCCT
CGACGTGCTTTTTTTCGTCGATGGCCTTTTTCTCTTCTTCGCGGCGTGCAACGGCGTCGCACCGCGTGTGGAGCTNNNNNNNNNNNNNNNNNNNNNNNNN
NCAATCTGCGTTGTGAGCTCCTTGACGTCGGAGTCAAGTTGTCGGATCCGCTGCTCGACCTCCATTTTTTTCTGCTCGGCCATGAGCGCCTTGCGCATCC
CGAACGCGATGCTCGACTCGTACAGCGTCTGATACGCGGCGATCGTCATGCGCGCTTCATCACGCACACGAAGCAGCAGCAATCCACGCTCGGAGCAATT
GATCGTGATCTGGCGAATCAATTCGTCTGATTTTGATGCGATGCGGACAAGAACAAACGATTGTTGGCGTCAGTATTTGTTACCCGAGGCGGCGGCAAGC
TCGTCATACAACTTACGTACCAAAGCACTGCGCATAGAGCTCTTCACGCACAGGACAGATGCCGGTTTCACGTGCCTGTCGTTGCTGAAGCCGCAGATCC
AGTTGCTCCTGGAGATTCACGACGTCCAGACGCGTCGCGGGCGTGCTCGAGACGTACTGGACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGA
CCGTCCTCAGTCCACTCCTTGGGAGGCAGGATCGAATTGAGGATGTCTTCGGTCTGCGATTGGCTCTGCGTGTGGCTGCCCGTGAACACTGTCGGCTTCT
GA